TkAUNG047190 | RubberDandelionOmics

Gene overview

TkAUNG047190

Reference: TK1151 Chr: ChrUn Coordinates: 13054822-13057748 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

963 bp · TkAUNG047190|TK1151|cDNA

ATGGAGTGGGATAGCAACTCGGATTCTGATCTAAGCGGCGATGAGGAGGTGGAGGAAGAGAGGAGAGGCGGTGGGCTTCCTTTCCCTGTCGACACGCTTCTGCAACCGGCGCCTTGTGGCTTTGTTGTTACGGATGCTTTGGAGCCGGATAATCCCATTATTTATGTCAATTCGGTGTTCGAAATGGTTACTGGATACCGCGCCGAGGAAGTTCTTGGTCGTAACTGCCGCTTCTTGCAATGCAGAGGCCCATTTTCCAA...

CDS

Download CDS FASTA

963 bp · TkAUNG047190|TK1151|CDS

ATGGAGTGGGATAGCAACTCGGATTCTGATCTAAGCGGCGATGAGGAGGTGGAGGAAGAGAGGAGAGGCGGTGGGCTTCCTTTCCCTGTCGACACGCTTCTGCAACCGGCGCCTTGTGGCTTTGTTGTTACGGATGCTTTGGAGCCGGATAATCCCATTATTTATGTCAATTCGGTGTTCGAAATGGTTACTGGATACCGCGCCGAGGAAGTTCTTGGTCGTAACTGCCGCTTCTTGCAATGCAGAGGCCCATTTTCCAA...

Protein

Download Protein FASTA

320 aa · TkAUNG047190|TK1151|PROTEIN

MEWDSNSDSDLSGDEEVEEERRGGGLPFPVDTLLQPAPCGFVVTDALEPDNPIIYVNSVFEMVTGYRAEEVLGRNCRFLQCRGPFSKRRHPLVNPTIVAEMRRCLDEGIEFQGELLNFRKDGSPLMNRLRMTPIYGDDDTITHIIGIQVFKEVTLDLGPLPGSLAKESTRKSDRFKFNVSPCKVMSDRSRNIGHGLCGIMELSDEVLLLKILYRLTPRDIASVGSVCRRLYELTKNEDLWRMVCQNAWGSETTRVLETVP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG047190`
TK1151 ID	TkAUNG047190
OH-1004 ID	LXL04_028378
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	75.500
Protein coverage (%)	TK1151 99.062 / OH-1004 51.724 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkAUNG047190

Location ChrUn:13054822-13057748 (+)

Description Similar to ADO1: Adagio protein 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g57360`	Component of an E3 ubiquitin ligase complex that plays a central role in blue light-dependent circadian cycles.	LKP1 (LOV kelch protein 1): a factor involved in the regulation of flowering time in arabidopsis.2000 · DOI: 10.1046/j.1365-313x.2000.00850.x An Arabidopsis circadian clock component interacts with both CRY1 and phyB.2001 · DOI: 10.1038/35068589 LOV KELCH PROTEIN2 and ZEITLUPE repress Arabidopsis photoperiodic flowering under non-inductive conditions, dependent on FLAVIN-BINDING KELCH REPEAT F-BOX1.2011 · DOI: 10.1111/j.1365-313x.2011.04618.x
`At2g18915`	Component of an E3 ubiquitin ligase complex that plays a central role in blue light-dependent circadian cycles.	A role for LKP2 in the circadian clock of Arabidopsis.2001 · DOI: 10.1105/tpc.010332 LOV KELCH PROTEIN2 and ZEITLUPE repress Arabidopsis photoperiodic flowering under non-inductive conditions, dependent on FLAVIN-BINDING KELCH REPEAT F-BOX1.2011 · DOI: 10.1111/j.1365-313x.2011.04618.x
`At1g68050`	Component of an E3 ubiquitin ligase complex that plays a central role in blue light-dependent circadian cycles.	FKF1, a clock-controlled gene that regulates the transition to flowering in Arabidopsis.2000 · DOI: 10.1016/s0092-8674(00)80842-9 Functional conservation of light, oxygen, or voltage domains in light sensing.2003 · DOI: 10.1073/pnas.1031791100 FKF1 is essential for photoperiodic-specific light signalling in Arabidopsis.2003 · DOI: 10.1038/nature02090 FKF1 F-box protein mediates cyclic degradation of a repressor of CONSTANS in Arabidopsis.2005 · DOI: 10.1126/science.1110586 FKF1 and GIGANTEA complex formation is required for day-length measurement in Arabidopsis.2007 · DOI: 10.1126/science.1146994 Arabidopsis DOF transcription factors act redundantly to reduce CONSTANS expression and are essential for a photoperiodic flowering response.2009 · DOI: 10.1016/j.devcel.2009.06.015 LOV KELCH PROTEIN2 and ZEITLUPE repress Arabidopsis photoperiodic flowering under non-inductive conditions, dependent on FLAVIN-BINDING KELCH REPEAT F-BOX1.2011 · DOI: 10.1111/j.1365-313x.2011.04618.x FKF1 conveys timing information for CONSTANS stabilization in photoperiodic flowering.2012 · DOI: 10.1126/science.1219644

Rice

Reference gene ID	Possible function	Papers / DOI
`Os06g0694000`	Component of an E3 ubiquitin ligase complex that plays a central role in blue light-dependent circadian cycles.	No verified direct reference in this release
`Os02g0150800`	Component of an E3 ubiquitin ligase complex that plays a central role in blue light-dependent circadian cycles.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_028378 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006511 ubiquitin-dependent protein catabolic process Biological Process

GO:0007623 circadian rhythm Biological Process

GO:0009637 response to blue light Biological Process

GO:0009908 flower development Biological Process

GO:0010114 response to red light Biological Process

GO:0010498 proteasomal protein catabolic process Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0031146 SCF-dependent proteasomal ubiquitin-dependent protein catabolic process Biological Process

GO:0042752 regulation of circadian rhythm Biological Process

GO:0043153 entrainment of circadian clock by photoperiod Biological Process

GO:0005634 nucleus Cellular Component

GO:0005829 cytosol Cellular Component

KEGG gene cross-reference

ath:AT2G18915

ath:AT5G57360

dosa:Os06g0694000

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.354

Rank 1 · TkAUNG047190 · TK1151

Cytoplasm0.316

Rank 2 · TkAUNG047190 · TK1151

Cell membrane0.206

Rank 3 · TkAUNG047190 · TK1151

Plastid0.108

Rank 4 · TkAUNG047190 · TK1151

Mitochondrion0.072

Rank 5 · TkAUNG047190 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00989PAS31-147 aa

PF13426PAS_939-148 aa

PF08448PAS_446-145 aa

PF08447PAS_353-147 aa

PF18511F-box_5201-233 aa

PF00646F-box206-241 aa

PF12937F-box-like207-245 aa

PF24681Kelch_KLHDC2_KLHL20_DRC7280-310 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG047190	`PF00989`	PAS	31	147	9.3e-09	36.0
TkAUNG047190	`PF13426`	PAS_9	39	148	1.1e-16	61.7
TkAUNG047190	`PF08448`	PAS_4	46	145	0.02	15.9
TkAUNG047190	`PF08447`	PAS_3	53	147	8e-08	33.2
TkAUNG047190	`PF18511`	F-box_5	201	233	0.032	14.5
TkAUNG047190	`PF00646`	F-box	206	241	1.6e-05	25.4
TkAUNG047190	`PF12937`	F-box-like	207	245	4e-10	40.0
TkAUNG047190	`PF24681`	Kelch_KLHDC2_KLHL20_DRC7	280	310	0.23	11.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94BT6`	Arabidopsis thaliana	sp\|Q94BT6\|ADO1_ARATH Adagio protein 1	71.800%	Swiss-Prot	High
`Q8W420`	Arabidopsis thaliana	sp\|Q8W420\|ADO2_ARATH Adagio protein 2	67.300%	Swiss-Prot	High
`Q9C9W9`	Arabidopsis thaliana	sp\|Q9C9W9\|ADO3_ARATH Adagio protein 3	59.900%	Swiss-Prot	High
`Q5Z8K3`	Oryza sativa subsp. japonica	sp\|Q5Z8K3\|ADO1_ORYSJ Adagio-like protein 1	68.500%	Swiss-Prot	High
`Q67UX0`	Oryza sativa subsp. japonica	sp\|Q67UX0\|ADO2_ORYSJ Putative adagio-like protein 2	66.400%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card