RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

LXL04_028378
Reference: OH-1004 Chr: Chr06 Coordinates: 39417869-39420516 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1830 bp · LXL04_028378|LXL04_028378|OH1004|cDNA

ATGGAGTGGGATAGTAGCAATTCTGATCTGAGCGGAGACGAGGAAGGGTTTTTATTGAATGATGGAGGTCCGCTGCCTTTCCCCGTCGACAGCCTGCTTCAACCGGCGCCGTGTGGGTTCGTTGTTACTGATGCGTTGGAGCCTGACAATCCCATTATATACGTGAATTCGGTTTTCGAGATCATAACTGGGTATCGCGCTGAAGAAGTCCTCGGTCGTAATTGTCGATTCTTACAATGCAGAGGTCCATATGCAAAAAG...

CDS

Download CDS FASTA

1830 bp · LXL04_028378|LXL04_028378|OH1004|CDS

ATGGAGTGGGATAGTAGCAATTCTGATCTGAGCGGAGACGAGGAAGGGTTTTTATTGAATGATGGAGGTCCGCTGCCTTTCCCCGTCGACAGCCTGCTTCAACCGGCGCCGTGTGGGTTCGTTGTTACTGATGCGTTGGAGCCTGACAATCCCATTATATACGTGAATTCGGTTTTCGAGATCATAACTGGGTATCGCGCTGAAGAAGTCCTCGGTCGTAATTGTCGATTCTTACAATGCAGAGGTCCATATGCAAAAAG...

Protein

Download Protein FASTA

609 aa · LXL04_028378|LXL04_028378|OH1004|PROTEIN

MEWDSSNSDLSGDEEGFLLNDGGPLPFPVDSLLQPAPCGFVVTDALEPDNPIIYVNSVFEIITGYRAEEVLGRNCRFLQCRGPYAKRRHPLVDSTIVSEIRKCLEDGIEFKGELLNFSKDGTPLMNRLRMTPIYGDDEVITHIIGIQFFTEVNLDLGPLQGSTITKHPLKPSSRSSLFSCRLTPDQTRGSTRGLCGILQLSDEVISLKILSRLTPRDIASVGSVCRRFYEVAKNEDLWRMVCRSAWGSETARVLETVTGG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDLXL04_028378
Source versionOH-1004 / GCA_047496595.1_OSU_TarKok_2.0
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDLXL04_028378
LocationChr06:39417869-39420516 (-)
DescriptionSimilar to ADO1: Adagio protein 1
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At5g57360 Component of an E3 ubiquitin ligase complex that plays a central role in blue light-dependent circadian cycles.
LKP1 (LOV kelch protein 1): a factor involved in the regulation of flowering time in arabidopsis.2000 · DOI: 10.1046/j.1365-313x.2000.00850.x
An Arabidopsis circadian clock component interacts with both CRY1 and phyB.2001 · DOI: 10.1038/35068589
LOV KELCH PROTEIN2 and ZEITLUPE repress Arabidopsis photoperiodic flowering under non-inductive conditions, dependent on FLAVIN-BINDING KELCH REPEAT F-BOX1.2011 · DOI: 10.1111/j.1365-313x.2011.04618.x
At2g18915 Component of an E3 ubiquitin ligase complex that plays a central role in blue light-dependent circadian cycles.
A role for LKP2 in the circadian clock of Arabidopsis.2001 · DOI: 10.1105/tpc.010332
LOV KELCH PROTEIN2 and ZEITLUPE repress Arabidopsis photoperiodic flowering under non-inductive conditions, dependent on FLAVIN-BINDING KELCH REPEAT F-BOX1.2011 · DOI: 10.1111/j.1365-313x.2011.04618.x
At1g68050 Component of an E3 ubiquitin ligase complex that plays a central role in blue light-dependent circadian cycles.
FKF1, a clock-controlled gene that regulates the transition to flowering in Arabidopsis.2000 · DOI: 10.1016/s0092-8674(00)80842-9
Functional conservation of light, oxygen, or voltage domains in light sensing.2003 · DOI: 10.1073/pnas.1031791100
FKF1 is essential for photoperiodic-specific light signalling in Arabidopsis.2003 · DOI: 10.1038/nature02090
FKF1 F-box protein mediates cyclic degradation of a repressor of CONSTANS in Arabidopsis.2005 · DOI: 10.1126/science.1110586
FKF1 and GIGANTEA complex formation is required for day-length measurement in Arabidopsis.2007 · DOI: 10.1126/science.1146994
Arabidopsis DOF transcription factors act redundantly to reduce CONSTANS expression and are essential for a photoperiodic flowering response.2009 · DOI: 10.1016/j.devcel.2009.06.015
LOV KELCH PROTEIN2 and ZEITLUPE repress Arabidopsis photoperiodic flowering under non-inductive conditions, dependent on FLAVIN-BINDING KELCH REPEAT F-BOX1.2011 · DOI: 10.1111/j.1365-313x.2011.04618.x
FKF1 conveys timing information for CONSTANS stabilization in photoperiodic flowering.2012 · DOI: 10.1126/science.1219644

Rice

Reference gene IDPossible functionPapers / DOI
Os06g0694000 Component of an E3 ubiquitin ligase complex that plays a central role in blue light-dependent circadian cycles. No verified direct reference in this release
Os02g0150800 Component of an E3 ubiquitin ligase complex that plays a central role in blue light-dependent circadian cycles. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_028378 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)
GO:0006511 ubiquitin-dependent protein catabolic process Biological Process
GO:0007623 circadian rhythm Biological Process
GO:0009637 response to blue light Biological Process
GO:0009908 flower development Biological Process
GO:0010114 response to red light Biological Process
GO:0010498 proteasomal protein catabolic process Biological Process
GO:0016567 protein ubiquitination Biological Process
GO:0031146 SCF-dependent proteasomal ubiquitin-dependent protein catabolic process Biological Process
GO:0042752 regulation of circadian rhythm Biological Process
GO:0043153 entrainment of circadian clock by photoperiod Biological Process
GO:0005634 nucleus Cellular Component
GO:0005829 cytosol Cellular Component
KEGG gene cross-reference
ath:AT2G18915
ath:AT5G57360
dosa:Os06g0694000
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.483
Rank 1 · LXL04_028378 · OH-1004
Nucleus0.350
Rank 2 · LXL04_028378 · OH-1004
Cell membrane0.116
Rank 3 · LXL04_028378 · OH-1004
Mitochondrion0.103
Rank 4 · LXL04_028378 · OH-1004
Endoplasmic reticulum0.067
Rank 5 · LXL04_028378 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00989.32PAS30-146 aa
PF13426.14PAS_938-147 aa
PF08447.19PAS_352-146 aa
PF00646.39F-box198-239 aa
PF12937.13F-box-like205-243 aa
PF13854.13Kelch_HCF257-415 aa
PF24681.2Kelch_KLHDC2_KLHL20_DRC7274-468 aa
PF24981.2Beta-prop_ATRN-LZTR1274-416 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
LXL04_028378PF00989.32PAS301462.2e-0834.8
LXL04_028378PF13426.14PAS_9381479.7e-1555.4
LXL04_028378PF08447.19PAS_3521463.1e-0628.1
LXL04_028378PF00646.39F-box1982392e-0628.2
LXL04_028378PF12937.13F-box-like2052431.1e-1145.1
LXL04_028378PF13854.13Kelch_HCF2574151.7e-2280.9
LXL04_028378PF24681.2Kelch_KLHDC2_KLHL20_DRC72744685.7e-73245.6
LXL04_028378PF24981.2Beta-prop_ATRN-LZTR12744162.3e-2486.9
LXL04_028378PF13415.13Beta-prop_FBX422754336.8e-48163.7
LXL04_028378PF13418.13Beta-prop_TYW42924911.9e-1454.9
LXL04_028378PF01344.32Kelch_12933278e-1864.3
LXL04_028378PF13854.13Kelch_HCF3315891.7e-2280.9
LXL04_028378PF24681.2Kelch_KLHDC2_KLHL20_DRC73935025.7e-73245.6
LXL04_028378PF24981.2Beta-prop_ATRN-LZTR14254982.3e-2486.9
LXL04_028378PF24681.2Kelch_KLHDC2_KLHL20_DRC74326065.7e-73245.6
LXL04_028378PF13415.13Beta-prop_FBX424346066.8e-48163.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q94BT6Arabidopsis thalianaAdagio protein 181.240%Swiss-Protstrong database homology
Q8W420Arabidopsis thalianaAdagio protein 273.366%Swiss-Protstrong database homology
Q9C9W9Arabidopsis thalianaAdagio protein 365.866%Swiss-Protstrong database homology
Q5Z8K3Oryza sativa subsp. japonicaAdagio-like protein 176.768%Swiss-Protstrong database homology
Q67UX0Oryza sativa subsp. japonicaPutative adagio-like protein 275.610%Swiss-Protstrong database homology

JBrowse

View in Genome Browser