TkAUNG027910 | RubberDandelionOmics

Gene overview

TkAUNG027910

Reference: TK1151 Chr: ChrUn Coordinates: 7496161-7498159 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1437 bp · TkAUNG027910|TK1151|cDNA

TAGCAAGCTAAGTTCCACCAATGAAACACTCCCACGTGTCTGCTTCTCATTGGCTATATACAAGCAACGTCTTTCCCATTCAGTCGACGGCGAACGATCGATTTATGAAAAAGAAGACCACAACAAAACACTCCGATAATCAATACATTATGGATCACCGGTTTCTCCTTCTCACATTGCATTCTCTTCTCGCCGTTACCTTTTTGGTCTCCGGTGGCGGTGCCAGCCCTGGTTCGGAAGACGATGTTTTCATCCGTCAG...

CDS

Download CDS FASTA

1233 bp · TkAUNG027910|TK1151|CDS

ATGAAACACTCCCACGTGTCTGCTTCTCATTGGCTATATACAAGCAACGTCTTTCCCATTCAGTCGACGGCGAACGATCGATTTATGAAAAAGAAGACCACAACAAAACACTCCGATAATCAATACATTATGGATCACCGGTTTCTCCTTCTCACATTGCATTCTCTTCTCGCCGTTACCTTTTTGGTCTCCGGTGGCGGTGCCAGCCCTGGTTCGGAAGACGATGTTTTCATCCGTCAGGTGGTCGACGACGGAGCCCA...

Protein

Download Protein FASTA

410 aa · TkAUNG027910|TK1151|PROTEIN

MKHSHVSASHWLYTSNVFPIQSTANDRFMKKKTTTKHSDNQYIMDHRFLLLTLHSLLAVTFLVSGGGASPGSEDDVFIRQVVDDGAQSLHTEEHHFGAFMRKFGKSYASQEEHDYRFTVFKTNIRRAKRHQKLDPSAVHGVTRFSDMTSAEFRKHLGLRSRLRFPADASEAPILPTSDLPDDFDWRDHGAVTDVKNQGSCGSCWSFSTTGALEGANFLATGKLESLSEQQLVDCDHECDPEEQESCDSGCDGGLMNSAFE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG027910`
TK1151 ID	TkAUNG027910
OH-1004 ID	LXL04_038220
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	98.400
Protein coverage (%)	TK1151 89.512 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkAUNG027910

Location ChrUn:7496161-7498159 (-)

Description Similar to RD19A: Cysteine protease RD19A

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g39090`	Probable thiol protease (By similarity).	No verified direct reference in this release
`At2g21430`	Probable thiol protease.	No verified direct reference in this release
`At4g16190`	Probable thiol protease.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_038220 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006508 proteolysis Biological Process

GO:0006970 response to osmotic stress Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009651 response to salt stress Biological Process

GO:0010269 response to selenium ion Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0051603 proteolysis involved in protein catabolic process Biological Process

GO:0000323 lytic vacuole Cellular Component

GO:0000325 plant-type vacuole Cellular Component

GO:0005576 extracellular region Cellular Component

GO:0005615 extracellular space Cellular Component

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT2G21430

ath:AT4G16190

ath:AT4G39090

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Lysosome / Vacuole0.646

Rank 1 · TkAUNG027910 · TK1151

Extracellular0.173

Rank 2 · TkAUNG027910 · TK1151

Cytoplasm0.169

Rank 3 · TkAUNG027910 · TK1151

Endoplasmic reticulum0.124

Rank 4 · TkAUNG027910 · TK1151

Cell membrane0.115

Rank 5 · TkAUNG027910 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08246Inhibitor_I2996-152 aa

PF00112Peptidase_C1179-403 aa

PF03051Peptidase_C1_2193-213 aa

PF03051Peptidase_C1_2364-387 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG027910	`PF08246`	Inhibitor_I29	96	152	9.3e-17	61.8
TkAUNG027910	`PF00112`	Peptidase_C1	179	403	1.3e-73	248.5
TkAUNG027910	`PF03051`	Peptidase_C1_2	193	213	0.0035	17.0
TkAUNG027910	`PF03051`	Peptidase_C1_2	364	387	0.0035	17.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P43296`	Arabidopsis thaliana	sp\|P43296\|RD19A_ARATH Cysteine protease RD19A	76.300%	Swiss-Prot	High
`P43295`	Arabidopsis thaliana	sp\|P43295\|RD19B_ARATH Probable cysteine protease RD19B	72.200%	Swiss-Prot	High
`Q9SUL1`	Arabidopsis thaliana	sp\|Q9SUL1\|RD19C_ARATH Probable cysteine protease RD19C	69.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card