TkAUNG019560 | RubberDandelionOmics

Gene overview

TkAUNG019560

Reference: TK1151 Chr: ChrUn Coordinates: 5225730-5230896 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3246 bp · TkAUNG019560|TK1151|cDNA

CCAAAGTTAGCCAATTTAGTGATTATCTAGAAAAATGTCTGATAAACCCTAGTCGAACTCGACCTCATAAAAGTCGCGATTACGCCAAACAACGCACCAGGGCTATCATATGCTACCACATGGCACTTTCGCTTACGTGGCATCTTATTATTGGTGTAGCATACCGATGACCACGTAGAGTCAACCTCCCAGAAAATAGATCACTCCTCGTTGGTTCTGTTAAATTCACTGCTACGCTAAAACCTCCGACTTACGTCTCC...

CDS

Download CDS FASTA

1584 bp · TkAUNG019560|TK1151|CDS

ATGAATCGATCTACAATGTCCAAAACGATTTTTAGGTTATGTTTAATTCTGCTTTTGCTGGTGTCGAATTCAGTTCCGTCTCGATCAGCCGTGTCCAGCATTGATCTGGGTTCTGAATGGATAAAAGTTGCGGTGGTGAATCTAAAACCTGGCCAAGCTCCGATATCTATCGCCATAAACGAAATGTCTAAACGGAAATCGCCTGCTCTAGTGGCGTTTCACGCTGGTGATCGTCTCATTGGCGAAGAGGCAGCTGGGCT...

Protein

Download Protein FASTA

527 aa · TkAUNG019560|TK1151|PROTEIN

MNRSTMSKTIFRLCLILLLLVSNSVPSRSAVSSIDLGSEWIKVAVVNLKPGQAPISIAINEMSKRKSPALVAFHAGDRLIGEEAAGLVARYPDKVYSNVRDLIGKPFSHVKKILDSLYLPFNVVEDSRGGVGIKIDDGVTVYSAEELTAMILGYALKLAEFHSKVPVKDAVITVPPYFGQAQRKGLLQAAQLAGLNALSLVNEHSGAALQYGIDKDFSNGSRHVVFYDMGSSSTYAALVYFSAYNTKEYGKTVSVNQFQV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG019560`
TK1151 ID	TkAUNG019560
OH-1004 ID	LXL04_025605
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 99.810 / OH-1004 60.114 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkAUNG019560

Location ChrUn:5225730-5230896 (+)

Description Similar to HSP70-17: Heat shock 70 kDa protein 17

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g16660`	Heat shock 70 kDa protein 17.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025605 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006950 response to stress Biological Process

GO:0030968 endoplasmic reticulum unfolded protein response Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005788 endoplasmic reticulum lumen Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0034663 endoplasmic reticulum chaperone complex Cellular Component

GO:0099503 secretory vesicle Cellular Component

GO:0000774 adenyl-nucleotide exchange factor activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0016887 ATP hydrolysis activity Molecular Function

KEGG gene cross-reference

ath:AT4G16660

ddi:DDB_G0273093

ddi:DDB_G0273813

dre:327133

xtr:779444

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.393

Rank 1 · TkAUNG019560 · TK1151

Golgi apparatus0.335

Rank 2 · TkAUNG019560 · TK1151

Lysosome / Vacuole0.072

Rank 3 · TkAUNG019560 · TK1151

Cytoplasm0.072

Rank 4 · TkAUNG019560 · TK1151

Extracellular0.070

Rank 5 · TkAUNG019560 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00012HSP7034-515 aa

PF06723MreB_Mbl145-239 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG019560	`PF00012`	HSP70	34	515	4.2e-87	293.5
TkAUNG019560	`PF06723`	MreB_Mbl	145	239	0.041	13.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4JMJ1`	Arabidopsis thaliana	sp\|F4JMJ1\|HSP7R_ARATH Heat shock 70 kDa protein 17	73.500%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card