LXL04_025605 | RubberDandelionOmics

Gene overview

LXL04_025605

Reference: OH-1004 Chr: Chr05 Coordinates: 114108980-114113511 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2628 bp · LXL04_025605|LXL04_025605|OH1004|cDNA

ATGAATCGATCTACAATGTCCAAAACGATTTTTAGGTTATGTTTAATTCTCCTTTTGCTGGTGTCGAATTCAGTTCCGTCTCGATCAGCCGTGTCCAGCATTGATCTGGGTTCTGAATGGATAAAAGTTGCGGTGGTGAATCTAAAACCTGGTCAAGCTCCGATATCTATCGCCATAAACGAAATGTCTAAACGGAAATCGCCTGCTCTAGTGGCGTTTCACGCTGGTGATCGTCTCATTGGCGAAGAGGCAGCTGGGCT...

CDS

Download CDS FASTA

2628 bp · LXL04_025605|LXL04_025605|OH1004|CDS

ATGAATCGATCTACAATGTCCAAAACGATTTTTAGGTTATGTTTAATTCTCCTTTTGCTGGTGTCGAATTCAGTTCCGTCTCGATCAGCCGTGTCCAGCATTGATCTGGGTTCTGAATGGATAAAAGTTGCGGTGGTGAATCTAAAACCTGGTCAAGCTCCGATATCTATCGCCATAAACGAAATGTCTAAACGGAAATCGCCTGCTCTAGTGGCGTTTCACGCTGGTGATCGTCTCATTGGCGAAGAGGCAGCTGGGCT...

Protein

Download Protein FASTA

875 aa · LXL04_025605|LXL04_025605|OH1004|PROTEIN

MNRSTMSKTIFRLCLILLLLVSNSVPSRSAVSSIDLGSEWIKVAVVNLKPGQAPISIAINEMSKRKSPALVAFHAGDRLIGEEAAGLVARYPDKVYSNVRDLIGKPFSHVKKILDSLYLPFNVVEDSRGGVGIKIDDGVTVYSAEELTAMILGYALKLAEFHSKVPVKDAVITVPPYFGQAQRKGLLQAAQLAGLNALSLVNEHSGAALQYGIDKDFSNGSRHVVFYDMGSSSTYAALVYFSAYNTKEYGKTVSVNQFQV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_025605`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_025605

Location Chr05:114108980-114113511 (-)

Description Similar to HSP70-17: Heat shock 70 kDa protein 17

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g16660`	Heat shock 70 kDa protein 17.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025605 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006950 response to stress Biological Process

GO:0030968 endoplasmic reticulum unfolded protein response Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005788 endoplasmic reticulum lumen Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0034663 endoplasmic reticulum chaperone complex Cellular Component

GO:0099503 secretory vesicle Cellular Component

GO:0000774 adenyl-nucleotide exchange factor activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0016887 ATP hydrolysis activity Molecular Function

KEGG gene cross-reference

ath:AT4G16660

ddi:DDB_G0273093

ddi:DDB_G0273813

dre:327133

xtr:779444

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.812

Rank 1 · LXL04_025605 · OH-1004

Golgi apparatus0.152

Rank 2 · LXL04_025605 · OH-1004

Cytoplasm0.089

Rank 3 · LXL04_025605 · OH-1004

Nucleus0.059

Rank 4 · LXL04_025605 · OH-1004

Cell membrane0.044

Rank 5 · LXL04_025605 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00012.27HSP7034-728 aa

PF27508.1HYOU1_C759-813 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_025605	`PF00012.27`	HSP70	34	728	4.2e-96	323.2
LXL04_025605	`PF27508.1`	HYOU1_C	759	813	1.1e-06	29.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4JMJ1`	Arabidopsis thaliana	Heat shock 70 kDa protein 17	68.598%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card