TkAUNG011880 | RubberDandelionOmics

Gene overview

TkAUNG011880

Reference: TK1151 Chr: ChrUn Coordinates: 2836755-2838770 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1440 bp · TkAUNG011880|TK1151|cDNA

ATGCCTCAACTAGATAAATTCACTTATTTCACACAATTCTTCTGGTCATGCCTTTTCCTCTTTACTTTCTATATTGCCATATGCAATGATGGAGATGGAGTACTTGGGATCAGCAGAATTCTAAAACTACGGAACCAACTGGTTTCACACCGGGAGACCAACATCCGGAGCAACGACCCCAAGAGTTTGGAAGAGATCTTGAGAAAAGGTTTTAGCACCGGTGTATCCTATATGTACTCCAGTTTATTCGAAGTATCCCA...

CDS

Download CDS FASTA

1440 bp · TkAUNG011880|TK1151|CDS

ATGCCTCAACTAGATAAATTCACTTATTTCACACAATTCTTCTGGTCATGCCTTTTCCTCTTTACTTTCTATATTGCCATATGCAATGATGGAGATGGAGTACTTGGGATCAGCAGAATTCTAAAACTACGGAACCAACTGGTTTCACACCGGGAGACCAACATCCGGAGCAACGACCCCAAGAGTTTGGAAGAGATCTTGAGAAAAGGTTTTAGCACCGGTGTATCCTATATGTACTCCAGTTTATTCGAAGTATCCCA...

Protein

Download Protein FASTA

479 aa · TkAUNG011880|TK1151|PROTEIN

MPQLDKFTYFTQFFWSCLFLFTFYIAICNDGDGVLGISRILKLRNQLVSHRETNIRSNDPKSLEEILRKGFSTGVSYMYSSLFEVSQWCNAVDLLGKRKKITLISCFGELSGSRGMERNIFYLISKSSYSTSSNPGWGITCRNDIMLMHVLHGQGSIAQLERSTSAFGRWRRTEAKWFMIESQRHSYHLVDPSPWPISGSLGALATTVGGVMYMHSFQGGATLLSLGLIFILYTMFVWWRDVLRESTLEGHHTKVVQLGP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG011880`
TK1151 ID	TkAUNG011880
OH-1004 ID	LXL04_039960
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	50.500
Protein coverage (%)	TK1151 96.033 / OH-1004 99.713 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkAUNG011880

Location ChrUn:2836755-2838770 (-)

Description Similar to YMF19: Putative ATP synthase protein YMF19

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`UniProt: P92514`	Component of the cytochrome c oxidase, the last enzyme in the mitochondrial electron transport chain which drives oxidative phosphorylation.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: P14852`	Component of the cytochrome c oxidase, the last enzyme in the mitochondrial electron transport chain which drives oxidative phosphorylation.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_039960 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006754 ATP biosynthetic process Biological Process

GO:1902600 proton transmembrane transport Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0031966 mitochondrial membrane Cellular Component

GO:0045259 proton-transporting ATP synthase complex Cellular Component

GO:0005524 ATP binding Molecular Function

GO:0050897 cobalt ion binding Molecular Function

KEGG gene cross-reference

ath:AT2G07707

rsz:13630173

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.550

Rank 1 · TkAUNG011880 · TK1151

Plastid0.296

Rank 2 · TkAUNG011880 · TK1151

Endoplasmic reticulum0.058

Rank 3 · TkAUNG011880 · TK1151

Cytoplasm0.057

Rank 4 · TkAUNG011880 · TK1151

Nucleus0.047

Rank 5 · TkAUNG011880 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02326YMF192-82 aa

PF06449YMF19_C93-143 aa

PF00510COX3121-153 aa

PF00510COX3185-428 aa

PF02326YMF19273-280 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG011880	`PF02326`	YMF19	2	82	2.6e-23	83.4
TkAUNG011880	`PF06449`	YMF19_C	93	143	4.1e-34	116.9
TkAUNG011880	`PF00510`	COX3	121	153	1.3e-99	334.0
TkAUNG011880	`PF00510`	COX3	185	428	1.3e-99	334.0
TkAUNG011880	`PF02326`	YMF19	273	280	2.6e-23	83.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P92514`	Arabidopsis thaliana	sp\|P92514\|COX3_ARATH Cytochrome c oxidase subunit 3	96.000%	Swiss-Prot	Medium
`P14852`	Oryza sativa subsp. indica	sp\|P14852\|COX3_ORYSI Cytochrome c oxidase subunit 3	94.900%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card