LXL04_039960 | RubberDandelionOmics

Gene overview

LXL04_039960

Reference: OH-1004 Chr: JAJTUU010000137.1 Coordinates: 23922-25855 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1047 bp · LXL04_039960|LXL04_039960|OH1004|cDNA

ATGCCTCAACTAGATCAATTCACTTATTTCACACAATTCTTCTGGTCATGCCTTTTCCTCTTTACTTTCTATATTGCCATATGCAATGATGGAGATGGACTACTTGGGATCAGCAGAATTCTAAAACTACGTAACCAACTGCTTTCACACCGTACGAACAACATCCGGAGCAAGGACCCCAACAGTTTGGAAGATATCTTGAGAAAAGGTTTTAGCACCGGTCTATCCTATATGTACTCCAGTTTATTCGAAGTCTCCCA...

CDS

Download CDS FASTA

1047 bp · LXL04_039960|LXL04_039960|OH1004|CDS

ATGCCTCAACTAGATCAATTCACTTATTTCACACAATTCTTCTGGTCATGCCTTTTCCTCTTTACTTTCTATATTGCCATATGCAATGATGGAGATGGACTACTTGGGATCAGCAGAATTCTAAAACTACGTAACCAACTGCTTTCACACCGTACGAACAACATCCGGAGCAAGGACCCCAACAGTTTGGAAGATATCTTGAGAAAAGGTTTTAGCACCGGTCTATCCTATATGTACTCCAGTTTATTCGAAGTCTCCCA...

Protein

Download Protein FASTA

348 aa · LXL04_039960|LXL04_039960|OH1004|PROTEIN

MPQLDQFTYFTQFFWSCLFLFTFYIAICNDGDGLLGISRILKLRNQLLSHRTNNIRSKDPNSLEDILRKGFSTGLSYMYSSLFEVSQWCKAVDLLGKRRKITLISCFGEISGSRGMERNILYLISKRDSFSIRIVEWKALQERYTPFQIAPREDRRSERFSRFSIALFLVGRNSTGRERDQAEPLVELCSFLLSSLAPTVEIGGIWPPKGIAVLDPREIPFLNTLIPLSSGAAVTWAHHAILAGKEKRAVYALVATVSLA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_039960`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_039960

Location JAJTUU010000137.1:23922-25855 (-)

Description Similar to YMF19: Putative ATP synthase protein YMF19

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`UniProt: P93303`	This is one of the chains of the nonenzymatic component (CF(0) subunit) of the mitochondrial ATPase complex.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_039960 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006754 ATP biosynthetic process Biological Process

GO:1902600 proton transmembrane transport Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0031966 mitochondrial membrane Cellular Component

GO:0045259 proton-transporting ATP synthase complex Cellular Component

GO:0005524 ATP binding Molecular Function

GO:0050897 cobalt ion binding Molecular Function

KEGG gene cross-reference

ath:AT2G07707

rsz:13630173

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.304

Rank 1 · LXL04_039960 · OH-1004

Plastid0.294

Rank 2 · LXL04_039960 · OH-1004

Cytoplasm0.123

Rank 3 · LXL04_039960 · OH-1004

Nucleus0.122

Rank 4 · LXL04_039960 · OH-1004

Endoplasmic reticulum0.102

Rank 5 · LXL04_039960 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02326.21YMF192-82 aa

PF06449.16YMF19_C93-127 aa

PF00510.24COX3188-264 aa

PF00510.24COX3270-300 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_039960	`PF02326.21`	YMF19	2	82	5.8e-24	85.5
LXL04_039960	`PF06449.16`	YMF19_C	93	127	8.5e-20	71.0
LXL04_039960	`PF00510.24`	COX3	188	264	3.9e-33	116.1
LXL04_039960	`PF00510.24`	COX3	270	300	3.9e-33	116.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P93303`	Arabidopsis thaliana	ATP synthase protein YMF19	89.683%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card