TkAUNG001780 | RubberDandelionOmics

Gene overview

TkAUNG001780

Reference: TK1151 Chr: ChrUn Coordinates: 517552-519101 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1255 bp · TkAUNG001780|TK1151|cDNA

AACGGCGAAGCTAACGACAGGGTATTAGTAAAAGGGAGCAGGCAAATACGATTAGAGAATCTTTCTCCCTTCCACCTGCACAAACCCCCTTCTCCCTTCTCTCTTCGCGTATCGCTTTCACCATCGACGCCAGGCATGGCTATGCCTGAGCACCACCAATTCAACAACTACCTTCAACAACAACATCAGCAACCGCAGCAATCGAAGCCTTTCAGAGATATATTCAACAACATGGAAGGTCAGATTTCACCGCCGATCAA...

CDS

Download CDS FASTA

1152 bp · TkAUNG001780|TK1151|CDS

AACGGCGAAGCTAACGACAGGGTATTAGTAAAAGGGAGCAGGCAAATACGATTAGAGAATCTTTCTCCCTTCCACCTGCACAAACCCCCTTCTCCCTTCTCTCTTCGCGTATCGCTTTCACCATCGACGCCAGGCATGGCTATGCCTGAGCACCACCAATTCAACAACTACCTTCAACAACAACATCAGCAACCGCAGCAATCGAAGCCTTTCAGAGATATATTCAACAACATGGAAGGTCAGATTTCACCGCCGATCAA...

Protein

Download Protein FASTA

383 aa · TkAUNG001780|TK1151|PROTEIN

NGEANDRVLVKGSRQIRLENLSPFHLHKPPSPFSLRVSLSPSTPGMAMPEHHQFNNYLQQQHQQPQQSKPFRDIFNNMEGQISPPINYINADQAHHPPYIPQFHVVGFAPGTDVSDGGFDLQRNYDLEWRKKRPNEQEFLENNNTNSQISSIDFLQPRSVSTGLGLSLDNGRLASSGESSFIAGLMGDEIELELRRQDAEIDRFMKIQADRLRQSVLEKVHTNHLRIISHVEDKFIKKLHEKDSEIETINRKNLELESQV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG001780`
TK1151 ID	TkAUNG001780
OH-1004 ID	LXL04_009538
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	36.700
Protein coverage (%)	TK1151 63.185 / OH-1004 73.574 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkAUNG001780

Location ChrUn:517552-519101 (+)

Description Similar to BOI: E3 ubiquitin-protein ligase BOI

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g12920`	Probable E3 ubiquitin-protein ligase.	DELLA proteins and their interacting RING Finger proteins repress gibberellin responses by binding to the promoters of a subset of gibberellin-responsive genes in Arabidopsis.2013 · DOI: 10.1105/tpc.112.108951
`At5g45100`	E3 ubiquitin-protein ligase involved in regulation of abiotic stress responses.	DELLA proteins and their interacting RING Finger proteins repress gibberellin responses by binding to the promoters of a subset of gibberellin-responsive genes in Arabidopsis.2013 · DOI: 10.1105/tpc.112.108951
`At4g19700`	E3 ubiquitin-protein ligase involved in the regulation of pathogen and abiotic stress responses by facilitating degradation of MYB108/BOI.	No verified direct reference in this release
`At1g79110`	Probable E3 ubiquitin-protein ligase.	DELLA proteins and their interacting RING Finger proteins repress gibberellin responses by binding to the promoters of a subset of gibberellin-responsive genes in Arabidopsis.2013 · DOI: 10.1105/tpc.112.108951

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_009538 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006511 ubiquitin-dependent protein catabolic process Biological Process

GO:0006952 defense response Biological Process

GO:0007032 endosome organization Biological Process

GO:0009739 response to gibberellin Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0032479 regulation of type I interferon production Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0043067 regulation of programmed cell death Biological Process

GO:0043069 negative regulation of programmed cell death Biological Process

GO:0043161 proteasome-mediated ubiquitin-dependent protein catabolic process Biological Process

GO:0050687 negative regulation of defense response to virus Biological Process

GO:0050832 defense response to fungus Biological Process

KEGG gene cross-reference

ath:AT1G79110

ath:AT3G12920

ath:AT4G19700

ath:AT5G45100

mmu:213211

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.922

Rank 1 · TkAUNG001780 · TK1151

Cytoplasm0.151

Rank 2 · TkAUNG001780 · TK1151

Cell membrane0.031

Rank 3 · TkAUNG001780 · TK1151

Endoplasmic reticulum0.018

Rank 4 · TkAUNG001780 · TK1151

Plastid0.015

Rank 5 · TkAUNG001780 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF30907IPGA1_CC191-206 aa

PF26916DUF8275192-294 aa

PF24980LSU193-205 aa

PF30907IPGA1_CC211-278 aa

PF24980LSU245-275 aa

PF13920zf-C3HC4_3335-372 aa

PF14447Prok-RING_4337-372 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG001780	`PF30907`	IPGA1_CC	191	206	1.4	10.0
TkAUNG001780	`PF26916`	DUF8275	192	294	0.016	15.5
TkAUNG001780	`PF24980`	LSU	193	205	3.0	8.6
TkAUNG001780	`PF30907`	IPGA1_CC	211	278	1.4	10.0
TkAUNG001780	`PF24980`	LSU	245	275	3.0	8.6
TkAUNG001780	`PF13920`	zf-C3HC4_3	335	372	2.2e-08	34.5
TkAUNG001780	`PF14447`	Prok-RING_4	337	372	0.014	16.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LDD1`	Arabidopsis thaliana	sp\|Q9LDD1\|BRG3_ARATH Probable BOI-related E3 ubiquitin-protein ligase 3	32.700%	Swiss-Prot	Medium
`Q9FHE4`	Arabidopsis thaliana	sp\|Q9FHE4\|BRG1_ARATH BOI-related E3 ubiquitin-protein ligase 1	34.200%	Swiss-Prot	Low
`O81851`	Arabidopsis thaliana	sp\|O81851\|BOI_ARATH E3 ubiquitin-protein ligase BOI	34.600%	Swiss-Prot	Low
`F4IDI6`	Arabidopsis thaliana	sp\|F4IDI6\|BRG2_ARATH Probable BOI-related E3 ubiquitin-protein ligase 2	29.400%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card