TkA08G427210 | RubberDandelionOmics

Gene overview

TkA08G427210

Reference: TK1151 Chr: Chr08 Coordinates: 108558535-108560402 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

744 bp · TkA08G427210|TK1151|cDNA

ATGGCATCGACGCAAGGTAGATTACAACCGAGGAAATCGACTTCGAAATGTGCGAATTCGCCCTCGTCTTCAACTACTTCGTCTTCGAAACATTTTCCTGAAGCTTCTGTGGATAATCTGATCTCTCCGGCTTCATCTGCTAGAAGCAAGCCGCATTATTTTTACTCCGAGAGTTTGCCATTGGGTACCGAGAGATCGAAGGAGAATGTCACTGTTACTGTACGGTTCCGGCCTCTCAATCCGAGGGAAATTCGACGAGG...

CDS

Download CDS FASTA

744 bp · TkA08G427210|TK1151|CDS

ATGGCATCGACGCAAGGTAGATTACAACCGAGGAAATCGACTTCGAAATGTGCGAATTCGCCCTCGTCTTCAACTACTTCGTCTTCGAAACATTTTCCTGAAGCTTCTGTGGATAATCTGATCTCTCCGGCTTCATCTGCTAGAAGCAAGCCGCATTATTTTTACTCCGAGAGTTTGCCATTGGGTACCGAGAGATCGAAGGAGAATGTCACTGTTACTGTACGGTTCCGGCCTCTCAATCCGAGGGAAATTCGACGAGG...

Protein

Download Protein FASTA

247 aa · TkA08G427210|TK1151|PROTEIN

MASTQGRLQPRKSTSKCANSPSSSTTSSSKHFPEASVDNLISPASSARSKPHYFYSESLPLGTERSKENVTVTVRFRPLNPREIRRGEEIAWYADGETILRNEETPSIAYAYDRVFGPTTTTRHVYDIAAQHVVSGAMEGVNGTIFAYGVTSSGKTHTMHGDQRSPGIIPLAIKDAFSIIQETLDHEFLLRVSYLEIYNEVVNDLLNPAGQNLRIREDNQGAFVEGIKEEVVLSPTHALSLIAARRT

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G427210`
TK1151 ID	TkA08G427210
OH-1004 ID	LXL04_032877
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	96.700
Protein coverage (%)	TK1151 98.785 / OH-1004 27.822 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G427210

Location Chr08:108558535-108560402 (-)

Description Similar to KIN7K: Kinesin-like protein KIN-7K, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g12020`	Kinesin-like protein KIN-7K, chloroplastic.	No verified direct reference in this release
`At5g06670`	Kinesin-like protein KIN-7L, chloroplastic.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0775400`	Probable minus end-directed motor protein with a microtubule-enhanced ATPase activity.	No verified direct reference in this release
`Os04g0434600`	Kinesin-like protein KIN-7E, chloroplastic.	No verified direct reference in this release
`Os06g0206700`	Kinesin-like protein KIN-7G.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032877 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0007018 microtubule-based movement Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005871 kinesin complex Cellular Component

GO:0005874 microtubule Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0000287 magnesium ion binding Molecular Function

GO:0003777 microtubule motor activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0008017 microtubule binding Molecular Function

GO:0016887 ATP hydrolysis activity Molecular Function

GO:0042803 protein homodimerization activity Molecular Function

GO:0043531 ADP binding Molecular Function

KEGG gene cross-reference

ath:AT3G12020

ath:AT5G06670

osa:9271714

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.700

Rank 1 · TkA08G427210 · TK1151

Nucleus0.353

Rank 2 · TkA08G427210 · TK1151

Cell membrane0.080

Rank 3 · TkA08G427210 · TK1151

Lysosome / Vacuole0.050

Rank 4 · TkA08G427210 · TK1151

Peroxisome0.041

Rank 5 · TkA08G427210 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16796Microtub_bd69-206 aa

PF00225Kinesin75-243 aa

PF30059DIA2_191-229 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G427210	`PF16796`	Microtub_bd	69	206	9.4e-20	71.8
TkA08G427210	`PF00225`	Kinesin	75	243	2.6e-45	155.6
TkA08G427210	`PF30059`	DIA2_	191	229	0.012	16.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4J8L3`	Arabidopsis thaliana	sp\|F4J8L3\|KN7K_ARATH Kinesin-like protein KIN-7K, chloroplastic	78.000%	Swiss-Prot	High
`F4K3X8`	Arabidopsis thaliana	sp\|F4K3X8\|KN7L_ARATH Kinesin-like protein KIN-7L, chloroplastic	79.100%	Swiss-Prot	High
`Q6YZ52`	Oryza sativa subsp. japonica	sp\|Q6YZ52\|KN7D_ORYSJ Kinesin-like protein KIN-7D, chloroplastic	88.800%	Swiss-Prot	High
`B9FFA3`	Oryza sativa subsp. japonica	sp\|B9FFA3\|KN7E_ORYSJ Kinesin-like protein KIN-7E, chloroplastic	79.900%	Swiss-Prot	High
`B9FS33`	Oryza sativa subsp. japonica	sp\|B9FS33\|KN7G_ORYSJ Kinesin-like protein KIN-7G	80.100%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card