LXL04_032877 | RubberDandelionOmics

Gene overview

LXL04_032877

Reference: OH-1004 Chr: Chr07 Coordinates: 30929272-30934069 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2634 bp · LXL04_032877|LXL04_032877|OH1004|cDNA

ATGGCTTCGACGCAAGGTAGATTACAACCGAGGAAATCGACTTCGAAATATGCGAATTCGCCCTCGTCTTCAACTACTTCATCTTCGAAACATTTTCCTGAAGCTTCTGTGGATAATCTGAGCTCTCCGGCTTCGTCTGCTAGAAGCAAGCCGCATTATTTTTACTCCGAGAGTTTGCCATTGGGTTCCGAGAGATCGAAGGAGAATGTCACTGTTACTGTACGGTTCCGGCCTCTCAGTCCGAGGGAAATTCGACGAGG...

CDS

Download CDS FASTA

2634 bp · LXL04_032877|LXL04_032877|OH1004|CDS

ATGGCTTCGACGCAAGGTAGATTACAACCGAGGAAATCGACTTCGAAATATGCGAATTCGCCCTCGTCTTCAACTACTTCATCTTCGAAACATTTTCCTGAAGCTTCTGTGGATAATCTGAGCTCTCCGGCTTCGTCTGCTAGAAGCAAGCCGCATTATTTTTACTCCGAGAGTTTGCCATTGGGTTCCGAGAGATCGAAGGAGAATGTCACTGTTACTGTACGGTTCCGGCCTCTCAGTCCGAGGGAAATTCGACGAGG...

Protein

Download Protein FASTA

877 aa · LXL04_032877|LXL04_032877|OH1004|PROTEIN

MASTQGRLQPRKSTSKYANSPSSSTTSSSKHFPEASVDNLSSPASSARSKPHYFYSESLPLGSERSKENVTVTVRFRPLSPREIRRGEEIAWYADGETILRNEETPSIAYAYDRVFGPTTTTRQVYDIAAQHVVSGAMEGVNGTIFAYGVTSSGKTHTMHGDQRSPGIIPLAIKDAFSIIQETPDHEFLLRVSYLEIYNEVVNDLLNPAGQNLRIREDSQGAFVEGIKEEVVLSPAHALSLIAAGEEHRHVGSTNFNLLS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_032877`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_032877

Location Chr07:30929272-30934069 (+)

Description Similar to KIN7K: Kinesin-like protein KIN-7K, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g12020`	Kinesin-like protein KIN-7K, chloroplastic.	No verified direct reference in this release
`At5g06670`	Kinesin-like protein KIN-7L, chloroplastic.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0775400`	Probable minus end-directed motor protein with a microtubule-enhanced ATPase activity.	No verified direct reference in this release
`Os06g0206700`	Kinesin-like protein KIN-7G.	No verified direct reference in this release
`Os04g0434600`	Kinesin-like protein KIN-7E, chloroplastic.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032877 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0007018 microtubule-based movement Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005871 kinesin complex Cellular Component

GO:0005874 microtubule Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0000287 magnesium ion binding Molecular Function

GO:0003777 microtubule motor activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0008017 microtubule binding Molecular Function

GO:0016887 ATP hydrolysis activity Molecular Function

GO:0042803 protein homodimerization activity Molecular Function

GO:0043531 ADP binding Molecular Function

KEGG gene cross-reference

ath:AT3G12020

ath:AT5G06670

osa:9271714

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.642

Rank 1 · LXL04_032877 · OH-1004

Nucleus0.275

Rank 2 · LXL04_032877 · OH-1004

Cell membrane0.153

Rank 3 · LXL04_032877 · OH-1004

Golgi apparatus0.059

Rank 4 · LXL04_032877 · OH-1004

Lysosome / Vacuole0.049

Rank 5 · LXL04_032877 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16796.12Microtub_bd69-206 aa

PF00225.30Kinesin75-388 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_032877	`PF16796.12`	Microtub_bd	69	206	1.1e-19	71.6
LXL04_032877	`PF00225.30`	Kinesin	75	388	3e-106	355.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4J8L3`	Arabidopsis thaliana	Kinesin-like protein KIN-7K, chloroplastic	59.627%	Swiss-Prot	strong database homology
`F4K3X8`	Arabidopsis thaliana	Kinesin-like protein KIN-7L, chloroplastic	55.496%	Swiss-Prot	strong database homology
`Q6YZ52`	Oryza sativa subsp. japonica	Kinesin-like protein KIN-7D, chloroplastic	53.198%	Swiss-Prot	strong database homology
`B9FS33`	Oryza sativa subsp. japonica	Kinesin-like protein KIN-7G	50.849%	Swiss-Prot	strong database homology
`B9FFA3`	Oryza sativa subsp. japonica	Kinesin-like protein KIN-7E, chloroplastic	65.905%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card