TkA08G307470 | RubberDandelionOmics

Gene overview

TkA08G307470

Reference: TK1151 Chr: Chr08 Coordinates: 79548219-79560851 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

6432 bp · TkA08G307470|TK1151|cDNA

TTGCATTAGCATAGTCAATATGCTGAAGTAGCAAGTATTTCCAACGTCCCTTTCTCCGTCTCTTTCTCTCTCTCATATGTATTCGTGGGGAAGCTTCTCTTTTGCTTATCAGATTTTACTTCGTTGCACCTACTTTTTCTGATTGAATGTCTCCTTATCCATATACTCACCCACCTCCAGAGACACACAAAACACATGTAGTAGTAGAAAAGAATCACTGTCGATAGTCATGCCAAAGTTAGCTTCTATGGAACTCTGAA...

CDS

Download CDS FASTA

5829 bp · TkA08G307470|TK1151|CDS

ATGGCGTACCCTCGAAGGGCATCTGAGCAGCAGCCACCTGGCAAGCTGCTGAGAACTCAAACAGCTGGCAATTTGGGAGGGGAGGCGATGATGGATAGTGAAGTAGTGCCTTCATCTCTTGTTACAATTGCACCTATTCTTCGTGTTGCTAATGAAGTTGAACCTACCAATCCAAGGGTTGCCTATCTCTGTCGATTCTATGCCTTTGAGCAAGCTCACAAACTAGATCCAACATCAAGTGGTCGTGGTGTTCGTCAATT...

Protein

Download Protein FASTA

1942 aa · TkA08G307470|TK1151|PROTEIN

MAYPRRASEQQPPGKLLRTQTAGNLGGEAMMDSEVVPSSLVTIAPILRVANEVEPTNPRVAYLCRFYAFEQAHKLDPTSSGRGVRQFKTALLQRLEREDATTLIGRKNSDAREMQSYYRHFYGKYIQALQNADKADRTRLTKAYQTAAVLFEVLKAVNLGESVDVAEEILEAHKKVADKTEMYAPYNILPLDPDSSNQAIMRLPEIQASVTALRNTRGLPWPKGYKKKPDEDILDWLQTMFGFQKDSVSNQREHLILLLA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G307470`
TK1151 ID	TkA08G307470
OH-1004 ID	LXL04_033709
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.800
Protein coverage (%)	TK1151 100.000 / OH-1004 58.635 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G307470

Location Chr08:79548219-79560851 (+)

Description Similar to CALS3: Callose synthase 3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g31960`	Involved in callose synthesis at the forming cell plate during cytokinesis.	No verified direct reference in this release
`At1g05570`	Involved in callose synthesis at the forming cell plate during cytokinesis.	An Arabidopsis Callose Synthase, GSL5, Is Required for Wound and Papillary Callose Formation.2003 · DOI: 10.1105/tpc.016097
`At5g13000`	Involved in callose synthesis at the forming cell plate during cytokinesis.	No verified direct reference in this release
`At2g13680`	Required for the formation of the callose wall separating the tetraspores (interstitial wall) and surrounding the pollen mother cells (peripheral wall).	Callose synthase (CalS5) is required for exine formation during microgametogenesis and for pollen viability in Arabidopsis.2005 · DOI: 10.1111/j.1365-313x.2005.02379.x Callose (beta-1,3 glucan) is essential for Arabidopsis pollen wall patterning, but not tube growth.2005 · DOI: 10.1186/1471-2229-5-22
`At5g36870`	Involved in callose synthesis at the forming cell plate during cytokinesis.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_033709 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006075 (1->3)-beta-D-glucan biosynthetic process Biological Process

GO:0008360 regulation of cell shape Biological Process

GO:0071555 cell wall organization Biological Process

GO:0000148 1,3-beta-D-glucan synthase complex Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009504 cell plate Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0003843 1,3-beta-D-glucan synthase activity Molecular Function

GO:0046527 glucosyltransferase activity Molecular Function

KEGG gene cross-reference

ath:AT1G05570

ath:AT2G31960

ath:AT5G13000

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.670

Rank 1 · TkA08G307470 · TK1151

Endoplasmic reticulum0.182

Rank 2 · TkA08G307470 · TK1151

Cytoplasm0.103

Rank 3 · TkA08G307470 · TK1151

Golgi apparatus0.093

Rank 4 · TkA08G307470 · TK1151

Lysosome / Vacuole0.076

Rank 5 · TkA08G307470 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04652Vta143-169 aa

PF14288FKS1_dom1318-430 aa

PF25968CALS1848-1035 aa

PF02364Glucan_synthase1043-1752 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G307470	`PF04652`	Vta1	43	169	1.4e-16	61.5
TkA08G307470	`PF14288`	FKS1_dom1	318	430	1.1e-42	145.5
TkA08G307470	`PF25968`	CALS1	848	1035	4e-62	209.8
TkA08G307470	`PF02364`	Glucan_synthase	1043	1752	9.9e-236	785.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SL03`	Arabidopsis thaliana	sp\|Q9SL03\|CALS2_ARATH Callose synthase 2	74.400%	Swiss-Prot	High
`Q9AUE0`	Arabidopsis thaliana	sp\|Q9AUE0\|CALS1_ARATH Callose synthase 1	73.700%	Swiss-Prot	High
`Q9LXT9`	Arabidopsis thaliana	sp\|Q9LXT9\|CALS3_ARATH Callose synthase 3	74.500%	Swiss-Prot	High
`Q3B724`	Arabidopsis thaliana	sp\|Q3B724\|CALS5_ARATH Callose synthase 5	58.700%	Swiss-Prot	High
`Q9LTG5`	Arabidopsis thaliana	sp\|Q9LTG5\|CALS4_ARATH Callose synthase 4	60.800%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card