TkA08G297890 | RubberDandelionOmics

Gene overview

TkA08G297890

Reference: TK1151 Chr: Chr08 Coordinates: 77203393-77206276 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1038 bp · TkA08G297890|TK1151|cDNA

ATGAGTAAGAGTATGAACGAATTGCTCATACGTATGAAAGAGGTAGAAATGAAAAAGGGTCTTCATACTGAAAGAGGTAGAAATGAAAAAGGGTCTTCATACTCACCCATTTATATTAGTCAAGATGCAAAAGGTATGTGGCATATGAACGTGTTTGGATCATTCCCAAAGCGTATGAGTCTCCCAAAATGCCCACACCTGCGTAGGAAGCTTGCACAAAGGGCTAGGTATTTATTCTTACTTCTCTCCAATTTTCTTTC...

CDS

Download CDS FASTA

1038 bp · TkA08G297890|TK1151|CDS

ATGAGTAAGAGTATGAACGAATTGCTCATACGTATGAAAGAGGTAGAAATGAAAAAGGGTCTTCATACTGAAAGAGGTAGAAATGAAAAAGGGTCTTCATACTCACCCATTTATATTAGTCAAGATGCAAAAGGTATGTGGCATATGAACGTGTTTGGATCATTCCCAAAGCGTATGAGTCTCCCAAAATGCCCACACCTGCGTAGGAAGCTTGCACAAAGGGCTAGGTATTTATTCTTACTTCTCTCCAATTTTCTTTC...

Protein

Download Protein FASTA

345 aa · TkA08G297890|TK1151|PROTEIN

MSKSMNELLIRMKEVEMKKGLHTERGRNEKGSSYSPIYISQDAKGMWHMNVFGSFPKRMSLPKCPHLRRKLAQRARYLFLLLSNFLSSAYLCFSRIASSVLDRFCVVFLNLRYFLWFKSWGSKKPHEIGLPLMKPNRIIKVEEDEPVLQAFKIMQEKGVGGVPVVASGGNKAVGNISIRDIQFLLIAPEIYKDYSLFFGDRCYCSGLISTFPMTWTTSLSSSYEYTTTAEAAVGIPCTPATLATFRRLVFSPADLRRLPA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G297890`
TK1151 ID	TkA08G297890
OH-1004 ID	LXL04_009401
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	97.500
Protein coverage (%)	TK1151 22.899 / OH-1004 18.676 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G297890

Location Chr08:77203393-77206276 (+)

Description Similar to KING1: SNF1-related protein kinase regulatory subunit gamma-1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g48530`	Regulatory subunit of the probable trimeric SNF1-related protein kinase (SnRK) complex, which may play a role in a signal transduction cascade regulating gene expression and carbohydrate metabolism in higher plants.	No verified direct reference in this release
`At1g69800`	Regulatory subunit of the probable trimeric SNF1-related protein kinase (SnRK) complex, which may play a role in a signal transduction cascade regulating gene expression and carbohydrate metabolism in higher plants.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_009401 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006110 regulation of glycolytic process Biological Process

GO:0006633 fatty acid biosynthetic process Biological Process

GO:0014873 response to muscle activity involved in regulation of muscle adaptation Biological Process

GO:0031669 cellular response to nutrient levels Biological Process

GO:0035556 intracellular signal transduction Biological Process

GO:0042128 nitrate assimilation Biological Process

GO:0042149 cellular response to glucose starvation Biological Process

GO:0045719 negative regulation of glycogen biosynthetic process Biological Process

GO:0045722 positive regulation of gluconeogenesis Biological Process

GO:0051726 regulation of cell cycle Biological Process

GO:0005615 extracellular space Cellular Component

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT1G69800

ath:AT3G48530

hsa:53632

mmu:241113

ssc:397149

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.404

Rank 1 · TkA08G297890 · TK1151

Cytoplasm0.303

Rank 2 · TkA08G297890 · TK1151

Cell membrane0.194

Rank 3 · TkA08G297890 · TK1151

Endoplasmic reticulum0.129

Rank 4 · TkA08G297890 · TK1151

Mitochondrion0.093

Rank 5 · TkA08G297890 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00571CBS137-181 aa

PF00571CBS313-327 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G297890	`PF00571`	CBS	137	181	2.5e-09	38.1
TkA08G297890	`PF00571`	CBS	313	327	2.5e-09	38.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LBB2`	Arabidopsis thaliana	sp\|Q8LBB2\|KING1_ARATH SNF1-related protein kinase regulatory subunit gamma-1	61.300%	Swiss-Prot	Low
`Q9CAR3`	Arabidopsis thaliana	sp\|Q9CAR3\|KINGL_ARATH SNF1-related protein kinase regulatory subunit gamma-1-like	43.000%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card