TkA08G297730 | RubberDandelionOmics

Gene overview

TkA08G297730

Reference: TK1151 Chr: Chr08 Coordinates: 77157336-77160005 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2225 bp · TkA08G297730|TK1151|cDNA

ACAAGGTTTACCTACTTCCAACCTCAGCTCTCCCCCAACCATCTTCTGCTCCTCCCATATGTCGCCACTGCCGCCCCTTTAATCTCTTTAGAAAAATCCAACAACGACCCTGCCTTCCCCATCTCCTCCGATTGCCACCGTATCCATGTATCTTCACCAAATTTAAAAGACATGTCTTCTTCAGGGGTCAACCTTGAAATTTATGTAATTCCGTTGGAGGAAATCAATCGTGCCACCGAAAACTTCATTCAAGAAAGATG...

CDS

Download CDS FASTA

1902 bp · TkA08G297730|TK1151|CDS

ACAAGGTTTACCTACTTCCAACCTCAGCTCTCCCCCAACCATCTTCTGCTCCTCCCATATGTCGCCACTGCCGCCCCTTTAATCTCTTTAGAAAAATCCAACAACGACCCTGCCTTCCCCATCTCCTCCGATTGCCACCGTATCCATGTATCTTCACCAAATTTAAAAGACATGTCTTCTTCAGGGGTCAACCTTGAAATTTATGTAATTCCGTTGGAGGAAATCAATCGTGCCACCGAAAACTTCATTCAAGAAAGATG...

Protein

Download Protein FASTA

633 aa · TkA08G297730|TK1151|PROTEIN

TRFTYFQPQLSPNHLLLLPYVATAAPLISLEKSNNDPAFPISSDCHRIHVSSPNLKDMSSSGVNLEIYVIPLEEINRATENFIQERCIGGGGFGLVYKGQLSDRWQNRTAAIKRLGRDSCQGEHEFRTELEMISTFHHENIISFIGYCDEGNEMILVYDYAINGSLDHHLQDPSKMCCITWTQRLKICIEAARGLNYLHSGLGEHNRVIHRDVKSSNILLDENLVAKICDFGLSKVGPRNQPDTQLYTRVAGTQFYLDPT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G297730`
TK1151 ID	TkA08G297730
OH-1004 ID	LXL04_033671
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	98.000
Protein coverage (%)	TK1151 63.507 / OH-1004 67.563 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G297730

Location Chr08:77157336-77160005 (-)

Description Similar to PUB13: U-box domain-containing protein 13

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g59700`	Probable receptor-like protein kinase At5g59700.	No verified direct reference in this release
`At3g46290`	Receptor-like protein kinase required for cell elongation during vegetative growth, mostly in a brassinosteroid-(BR-) independent manner.	Three related receptor-like kinases are required for optimal cell elongation in Arabidopsis thaliana.2009 · DOI: 10.1073/pnas.0812346106
`At5g39000`	Putative receptor-like protein kinase At5g39000.	No verified direct reference in this release
`At5g38990`	Probable receptor-like protein kinase At5g38990.	No verified direct reference in this release
`At2g39360`	Probable receptor-like protein kinase At2g39360.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_033671 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0007166 cell surface receptor signaling pathway Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0050777 negative regulation of immune response Biological Process

GO:2000028 regulation of photoperiodism, flowering Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0004842 ubiquitin-protein transferase activity Molecular Function

GO:0061630 ubiquitin protein ligase activity Molecular Function

GO:0070696 transmembrane receptor protein serine/threonine kinase binding Molecular Function

KEGG gene cross-reference

ath:AT2G28830

ath:AT3G46510

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.505

Rank 1 · TkA08G297730 · TK1151

Nucleus0.304

Rank 2 · TkA08G297730 · TK1151

Cell membrane0.299

Rank 3 · TkA08G297730 · TK1151

Endoplasmic reticulum0.048

Rank 4 · TkA08G297730 · TK1151

Golgi apparatus0.048

Rank 5 · TkA08G297730 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069Pkinase84-354 aa

PF07714PK_Tyr_Ser-Thr85-355 aa

PF00514Arm180-198 aa

PF01636APH197-239 aa

PF12330Haspin_kinase210-255 aa

PF25598ARM_PUB382-617 aa

PF13646HEAT_2391-442 aa

PF24768ARM_ARMC5400-554 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G297730	`PF00069`	Pkinase	84	354	5.9e-45	154.4
TkA08G297730	`PF07714`	PK_Tyr_Ser-Thr	85	355	7.1e-45	154.0
TkA08G297730	`PF00514`	Arm	180	198	3.6e-36	122.7
TkA08G297730	`PF01636`	APH	197	239	0.014	15.9
TkA08G297730	`PF12330`	Haspin_kinase	210	255	0.037	13.8
TkA08G297730	`PF25598`	ARM_PUB	382	617	4.7e-17	63.1
TkA08G297730	`PF13646`	HEAT_2	391	442	7.5e-09	36.5
TkA08G297730	`PF24768`	ARM_ARMC5	400	554	3e-18	66.9
TkA08G297730	`PF13513`	HEAT_EZ	406	442	3.1e-05	25.1
TkA08G297730	`PF00514`	Arm	407	446	3.6e-36	122.7
TkA08G297730	`PF05804`	KAP	409	533	0.05	12.5
TkA08G297730	`PF06371`	Drf_GBD	411	440	0.12	12.6
TkA08G297730	`PF04826`	Arm_2	412	457	0.042	14.1
TkA08G297730	`PF02985`	HEAT	419	446	4e-05	24.2
TkA08G297730	`PF05536`	Neurochondrin	420	472	0.019	14.1
TkA08G297730	`PF13646`	HEAT_2	421	524	7.5e-09	36.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FN92`	Arabidopsis thaliana	sp\|Q9FN92\|Y5597_ARATH Probable receptor-like protein kinase At5g59700	45.900%	Swiss-Prot	Low
`Q9LX66`	Arabidopsis thaliana	sp\|Q9LX66\|HERK_ARATH Receptor-like protein kinase HERK 1	45.800%	Swiss-Prot	Low
`Q9FID8`	Arabidopsis thaliana	sp\|Q9FID8\|Y5900_ARATH Putative receptor-like protein kinase At5g39000	44.900%	Swiss-Prot	Low
`Q9FID9`	Arabidopsis thaliana	sp\|Q9FID9\|Y5389_ARATH Probable receptor-like protein kinase At5g38990	44.900%	Swiss-Prot	Low
`O80623`	Arabidopsis thaliana	sp\|O80623\|Y2393_ARATH Probable receptor-like protein kinase At2g39360	41.800%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card