TkA08G217610 | RubberDandelionOmics

Gene overview

TkA08G217610

Reference: TK1151 Chr: Chr08 Coordinates: 56912736-56916582 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1803 bp · TkA08G217610|TK1151|cDNA

ATTTTAACAACCACACCCATATAAATACTAGAATTCCTTAGACGAAACTTCATACTCATACCCTAAAGATGCAAACAATGAGAAGAAGTCTAGTCCAATGGCTTCTCATTGCCACCTTCTTCACCTCACGAACCATGTCCATGGGTTCACCCAACAGGACTCCAAGACTTAGCCCTATCGACCCACGTTTACGGGACCCGAACACCGGTTTGGCAAGTGTTTCTAGCGACCATGAAACGTTTTTCTACAACCAGACGCTC...

CDS

Download CDS FASTA

1488 bp · TkA08G217610|TK1151|CDS

ATGCAAACAATGAGAAGAAGTCTAGTCCAATGGCTTCTCATTGCCACCTTCTTCACCTCACGAACCATGTCCATGGGTTCACCCAACAGGACTCCAAGACTTAGCCCTATCGACCCACGTTTACGGGACCCGAACACCGGTTTGGCAAGTGTTTCTAGCGACCATGAAACGTTTTTCTACAACCAGACGCTCGATCACTTCAATTACCAGCCCAAAAGTTACACCACCTTCCCACAACGCTATGTTATCAACTCTAAATG...

Protein

Download Protein FASTA

495 aa · TkA08G217610|TK1151|PROTEIN

MQTMRRSLVQWLLIATFFTSRTMSMGSPNRTPRLSPIDPRLRDPNTGLASVSSDHETFFYNQTLDHFNYQPKSYTTFPQRYVINSKWWGGAHTNAPIFAYFGAEGPIDQDINILGFFPENAPRFNALLVYIEHRFYGQSNPVGSMADSVKNKNLRGYFNSAQALADYAEVLQHIKKKLHAHNSPIIVIGGSYGGMLASWFRLKYPHIAFGALASSAPILYFDHLTPEDGYYSVVTNDFKEASENCYTTIRKSWDEIQKVA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G217610`
TK1151 ID	TkA08G217610
OH-1004 ID	LXL04_032981
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA08G217610`
Location	Chr08:56912736-56916582 (-)
Description	Similar to PRCP: Lysosomal Pro-X carboxypeptidase
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_032981` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0002003 angiotensin maturation Biological Process GO:0002155 regulation of thyroid hormone receptor signaling pathway Biological Process GO:0003085 negative regulation of systemic arterial blood pressure Biological Process GO:0006508 proteolysis Biological Process GO:0042593 glucose homeostasis Biological Process GO:0043535 regulation of blood vessel endothelial cell migration Biological Process GO:0097009 energy homeostasis Biological Process GO:2000377 regulation of reactive oxygen species metabolic process Biological Process GO:0005576 extracellular region Cellular Component GO:0005764 lysosome Cellular Component GO:0005886 plasma membrane Cellular Component GO:0031982 vesicle Cellular Component
KEGG gene cross-reference	bta:534927 hsa:29952 hsa:5547 mmu:72461 pon:100172335 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Lysosome / Vacuole0.473

Rank 1 · TkA08G217610 · TK1151

Extracellular0.289

Rank 2 · TkA08G217610 · TK1151

Cytoplasm0.131

Rank 3 · TkA08G217610 · TK1151

Endoplasmic reticulum0.122

Rank 4 · TkA08G217610 · TK1151

Cell membrane0.061

Rank 5 · TkA08G217610 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00326Peptidase_S98-39 aa

PF05577Peptidase_S2862-476 aa

PF05576Peptidase_S37130-365 aa

PF12146Hydrolase_4153-222 aa

PF00326Peptidase_S9162-268 aa

PF12697Abhydrolase_6162-215 aa

PF00561Abhydrolase_1163-220 aa

PF07859Abhydrolase_3163-198 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G217610	`PF00326`	Peptidase_S9	8	39	5.4e-06	26.8
TkA08G217610	`PF05577`	Peptidase_S28	62	476	5.8e-76	256.7
TkA08G217610	`PF05576`	Peptidase_S37	130	365	0.0034	16.9
TkA08G217610	`PF12146`	Hydrolase_4	153	222	8.7e-06	25.9
TkA08G217610	`PF00326`	Peptidase_S9	162	268	5.4e-06	26.8
TkA08G217610	`PF12697`	Abhydrolase_6	162	215	0.016	16.6
TkA08G217610	`PF00561`	Abhydrolase_1	163	220	0.00048	20.6
TkA08G217610	`PF07859`	Abhydrolase_3	163	198	0.099	13.1
TkA08G217610	`PF11144`	DUF2920	165	202	0.028	14.3
TkA08G217610	`PF01564`	Spermine_synth	167	203	0.13	12.5
TkA08G217610	`PF00756`	Esterase	168	220	0.15	12.5
TkA08G217610	`PF00561`	Abhydrolase_1	374	443	0.00048	20.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card