RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

LXL04_032981
Reference: OH-1004 Chr: Chr07 Coordinates: 32706391-32709923 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1488 bp · LXL04_032981|LXL04_032981|OH1004|cDNA

ATGCAAACAATGAGAAGAAGTCTAGTCCAATGGCTTCTCATTGCCACCTTCTTCACCTCACGAACCATGTCCATGGGTTCACCCAACAGGACTCCAAGACTTAGCCCTATCGACCAACGTTTACGGGACCCGAACACCGTTTTGGCAAGTGTTTCTAGCGACCATGAAACGTTTTTCTACAACCAGACGCTCGATCACTTCAATTACCAGCCCAAAAGTTACACCACCTTCCCACAACGCTATGTTATCAACTCTAAATG...

CDS

Download CDS FASTA

1488 bp · LXL04_032981|LXL04_032981|OH1004|CDS

ATGCAAACAATGAGAAGAAGTCTAGTCCAATGGCTTCTCATTGCCACCTTCTTCACCTCACGAACCATGTCCATGGGTTCACCCAACAGGACTCCAAGACTTAGCCCTATCGACCAACGTTTACGGGACCCGAACACCGTTTTGGCAAGTGTTTCTAGCGACCATGAAACGTTTTTCTACAACCAGACGCTCGATCACTTCAATTACCAGCCCAAAAGTTACACCACCTTCCCACAACGCTATGTTATCAACTCTAAATG...

Protein

Download Protein FASTA

495 aa · LXL04_032981|LXL04_032981|OH1004|PROTEIN

MQTMRRSLVQWLLIATFFTSRTMSMGSPNRTPRLSPIDQRLRDPNTVLASVSSDHETFFYNQTLDHFNYQPKSYTTFPQRYVINSKWWGGAHTNAPIFAYFGAEGPIDQDINILGFFPENAPRFNALLVYIEHRFYGQSNPVGSMADSVKNKNLRGYFNSAQALADYAEVLQHIKKKLHAHNSPIIVIGGSYGGMLASWFRLKYPHIAFGALASSAPILYFDHLTPEDGYYSVVTNDFKEASENCYTTIRKSWDEIQKVA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDLXL04_032981
Source versionOH-1004 / GCA_047496595.1_OSU_TarKok_2.0
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDLXL04_032981
LocationChr07:32706391-32709923 (-)
DescriptionSimilar to PRCP: Lysosomal Pro-X carboxypeptidase
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_032981 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)
GO:0002003 angiotensin maturation Biological Process
GO:0002155 regulation of thyroid hormone receptor signaling pathway Biological Process
GO:0003085 negative regulation of systemic arterial blood pressure Biological Process
GO:0006508 proteolysis Biological Process
GO:0042593 glucose homeostasis Biological Process
GO:0043535 regulation of blood vessel endothelial cell migration Biological Process
GO:0097009 energy homeostasis Biological Process
GO:2000377 regulation of reactive oxygen species metabolic process Biological Process
GO:0005576 extracellular region Cellular Component
GO:0005764 lysosome Cellular Component
GO:0005886 plasma membrane Cellular Component
GO:0031982 vesicle Cellular Component
KEGG gene cross-reference
bta:534927
hsa:29952
hsa:5547
mmu:72461
pon:100172335
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Lysosome / Vacuole0.468
Rank 1 · LXL04_032981 · OH-1004
Extracellular0.291
Rank 2 · LXL04_032981 · OH-1004
Cytoplasm0.131
Rank 3 · LXL04_032981 · OH-1004
Endoplasmic reticulum0.123
Rank 4 · LXL04_032981 · OH-1004
Cell membrane0.060
Rank 5 · LXL04_032981 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05577.19Peptidase_S2862-476 aa
PF12146.16Hydrolase_4153-222 aa
PF00326.28Peptidase_S9162-268 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
LXL04_032981PF05577.19Peptidase_S28624765.6e-76256.8
LXL04_032981PF12146.16Hydrolase_41532228.5e-0626.0
LXL04_032981PF00326.28Peptidase_S91622684.1e-0627.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser