TkA08G217090 | RubberDandelionOmics

Gene overview

TkA08G217090

Reference: TK1151 Chr: Chr08 Coordinates: 56752696-56755377 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2539 bp · TkA08G217090|TK1151|cDNA

TCTCATTTCACCCCTTCCAGTATTAAACTTTACATTTTCAACCCTTGTACCAGGTGAGGTACCTAGACCTCCACATAAGATGGAGCGAACTTGTCCGCCCAGACCAACCCCCCAGGAAGGAAAAGGCGCGGAAACGGAAGCTTCCGCCTTCCGGAACGCCTGCATTGTCGACAAGAAAGCTTCCGGAAGCAAAATCAGTTACGGGGTTGTTTTCGAGAACCAAAAGCACCTCCCTTCTCGTGTCTTAAAAAGCGTATTGG...

CDS

Download CDS FASTA

1587 bp · TkA08G217090|TK1151|CDS

ATGGAGACAAATGTCGAGTTTTTAATCACGTGTAAAAGATGTTACCAAGAAAAGTACGCGAAACCTCAAATTGTAATAAACGGCGATTCGCCTACAAGTCCATTGCTGTTACAAGGTCAAGAAAGTCAACATTCAACATCATCCGTAAAAGGTGGAAAACAAAACGGTACATTTGTAAGGCTGCACATTCCCGCAAATTCAAATCAATCGGGTCAGAAGAAAAAACCTGGTTCTACTCCTACAGTAAGTCAAACGAATAA...

Protein

Download Protein FASTA

528 aa · TkA08G217090|TK1151|PROTEIN

METNVEFLITCKRCYQEKYAKPQIVINGDSPTSPLLLQGQESQHSTSSVKGGKQNGTFVRLHIPANSNQSGQKKKPGSTPTVSQTNKSKSGKKSSKKGGGVESVDQSSKKLKSNGASKKKSSSKVTGAKLTLGLIWKKKTPDETGIDFRLKNILLKNNPNGHLLAPDCHLCNKPYDSSLMYIHCEGCDKWFHADAVELKESTMLDLVGFKCCRCRRIRIPVCPYTDPETRKKLEAKKKPMFRKKTLESDSNSETNEEQVN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G217090`
TK1151 ID	TkA08G217090
OH-1004 ID	LXL04_032969
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	96.600
Protein coverage (%)	TK1151 88.258 / OH-1004 28.174 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G217090

Location Chr08:56752696-56755377 (+)

Description Similar to PTM: DDT domain-containing protein PTM

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g35210`	Membrane-bound transcription factor required for the plastid-to-nucleus retrograde signaling.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032969 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000122 negative regulation of transcription by RNA polymerase II Biological Process

GO:0006338 chromatin remodeling Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0006508 proteolysis Biological Process

GO:0010019 chloroplast-nucleus signaling pathway Biological Process

GO:0010468 regulation of gene expression Biological Process

GO:0034728 nucleosome organization Biological Process

GO:0045824 negative regulation of innate immune response Biological Process

GO:0045892 negative regulation of DNA-templated transcription Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

KEGG gene cross-reference

ath:AT3G14980

ath:AT5G35210

ath:AT5G44800

dme:Dmel_CG32346

hsa:2186

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.948

Rank 1 · TkA08G217090 · TK1151

Cytoplasm0.161

Rank 2 · TkA08G217090 · TK1151

Cell membrane0.020

Rank 3 · TkA08G217090 · TK1151

Mitochondrion0.018

Rank 4 · TkA08G217090 · TK1151

Endoplasmic reticulum0.009

Rank 5 · TkA08G217090 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00628PHD5-15 aa

PF27108PHD_Pygo166-203 aa

PF00628PHD168-214 aa

PF31197PHD_JHD1168-199 aa

PF12171zf-C2H2_jaz168-180 aa

PF12171zf-C2H2_jaz184-192 aa

PF27108PHD_Pygo443-463 aa

PF00628PHD445-465 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G217090	`PF00628`	PHD	5	15	0.0056	17.4
TkA08G217090	`PF27108`	PHD_Pygo	166	203	0.026	15.3
TkA08G217090	`PF00628`	PHD	168	214	0.0056	17.4
TkA08G217090	`PF31197`	PHD_JHD1	168	199	0.031	14.9
TkA08G217090	`PF12171`	zf-C2H2_jaz	168	180	1.2	10.2
TkA08G217090	`PF12171`	zf-C2H2_jaz	184	192	1.2	10.2
TkA08G217090	`PF27108`	PHD_Pygo	443	463	0.026	15.3
TkA08G217090	`PF00628`	PHD	445	465	0.0056	17.4
TkA08G217090	`PF31197`	PHD_JHD1	445	466	0.031	14.9
TkA08G217090	`PF12171`	zf-C2H2_jaz	457	465	1.2	10.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4JYC8`	Arabidopsis thaliana	sp\|F4JYC8\|PTM_ARATH DDT domain-containing protein PTM	34.400%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card