LXL04_032969 | RubberDandelionOmics

Gene overview

LXL04_032969

Reference: OH-1004 Chr: Chr07 Coordinates: 32541893-32547662 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

5067 bp · LXL04_032969|LXL04_032969|OH1004|cDNA

ATGGAACCGGAGGTGGTTAAAACGGAGCGTCGAGGAAGAAAGAGGAAAAGGAAAGACGGGGAAGCCGCAAATAAAACAGCCAAAAAAGCGGCGGTTGGGATCAAGTCTAGGGTGCTTGTTGGGAGGTACGTGAAGAAGGAGTTTGCCGGAGTTGGTGTCTTCATCGGCAAGATTGTTTCTTATGATACCGGATTATATAGGGTTGATTACGAAGATGGGGATTGTGAGGATTTGGAGAGTGGTGAAGTGAAAGGGTTCAT...

CDS

Download CDS FASTA

4965 bp · LXL04_032969|LXL04_032969|OH1004|CDS

ATGGAACCGGAGGTGGTTAAAACGGAGCGTCGAGGAAGAAAGAGGAAAAGGAAAGACGGGGAAGCCGCAAATAAAACAGCCAAAAAAGCGGCGGTTGGGATCAAGTCTAGGGTGCTTGTTGGGAGGTACGTGAAGAAGGAGTTTGCCGGAGTTGGTGTCTTCATCGGCAAGATTGTTTCTTATGATACCGGATTATATAGGGTTGATTACGAAGATGGGGATTGTGAGGATTTGGAGAGTGGTGAAGTGAAAGGGTTCAT...

Protein

Download Protein FASTA

1654 aa · LXL04_032969|LXL04_032969|OH1004|PROTEIN

MEPEVVKTERRGRKRKRKDGEAANKTAKKAAVGIKSRVLVGRYVKKEFAGVGVFIGKIVSYDTGLYRVDYEDGDCEDLESGEVKGFIVEDKDMNADFRKRAKVLDQRVLKKYAKEKAVQSATAASKVDTMRSDNGKVGGNGVELANAEKVENSVRGGAFELSGAQTEVNNESSSELSDSEQSADLVEVETPSIPPPPPPPPQLPPSTGNFGVSEEHVPYLLSVYSFLRSFSVCLFLSPFGLDEFVGALNSSVPNTLLDAI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_032969`
TK1151 ID	TkA08G217090
OH-1004 ID	LXL04_032969
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	96.600
Protein coverage (%)	TK1151 88.258 / OH-1004 28.174 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_032969

Location Chr07:32541893-32547662 (+)

Description Similar to PTM: DDT domain-containing protein PTM

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g35210`	Membrane-bound transcription factor required for the plastid-to-nucleus retrograde signaling.	No verified direct reference in this release
`At5g44800`	Chromatin-remodeling protein that binds DNA through histones and regulates gene transcription.	No verified direct reference in this release
`At3g14980`	Histone H3 acetyltransferase that binds methylated DNA at chromatin sites lacking histone H3K4 di- or trimethylation and catalyzes H3K18 and H3K23 acetylation.	A histone acetyltransferase regulates active DNA demethylation in Arabidopsis.2012 · DOI: 10.1126/science.1219416 Antisilencing role of the RNA-directed DNA methylation pathway and a histone acetyltransferase in Arabidopsis.2012 · DOI: 10.1073/pnas.1208557109 Regulation of active DNA demethylation by an α-crystallin domain protein in Arabidopsis.2014 · DOI: 10.1016/j.molcel.2014.06.008

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032969 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000122 negative regulation of transcription by RNA polymerase II Biological Process

GO:0006338 chromatin remodeling Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0006508 proteolysis Biological Process

GO:0010019 chloroplast-nucleus signaling pathway Biological Process

GO:0010468 regulation of gene expression Biological Process

GO:0034728 nucleosome organization Biological Process

GO:0045824 negative regulation of innate immune response Biological Process

GO:0045892 negative regulation of DNA-templated transcription Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

KEGG gene cross-reference

ath:AT3G14980

ath:AT5G35210

ath:AT5G44800

dme:Dmel_CG32346

hsa:2186

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.955

Rank 1 · LXL04_032969 · OH-1004

Cytoplasm0.106

Rank 2 · LXL04_032969 · OH-1004

Cell membrane0.030

Rank 3 · LXL04_032969 · OH-1004

Endoplasmic reticulum0.014

Rank 4 · LXL04_032969 · OH-1004

Mitochondrion0.011

Rank 5 · LXL04_032969 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF21743.4PTM_DIR17_Tudor41-85 aa

PF02791.23DDT215-270 aa

PF15612.12WHIM1328-361 aa

PF00628.36PHD440-481 aa

PF24294.3Chromo_PTM998-1082 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_032969	`PF21743.4`	PTM_DIR17_Tudor	41	85	5.1e-14	52.5
LXL04_032969	`PF02791.23`	DDT	215	270	4.3e-15	56.3
LXL04_032969	`PF15612.12`	WHIM1	328	361	2.6e-07	30.8
LXL04_032969	`PF00628.36`	PHD	440	481	4.9e-09	36.8
LXL04_032969	`PF24294.3`	Chromo_PTM	998	1082	9.3e-30	103.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4JYC8`	Arabidopsis thaliana	DDT domain-containing protein PTM	41.843%	Swiss-Prot	moderate database homology
`F4KBP5`	Arabidopsis thaliana	Protein CHROMATIN REMODELING 4	45.098%	Swiss-Prot	weak database homology
`F4IXE7`	Arabidopsis thaliana	Increased DNA methylation 1	47.059%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card