TkA08G213620 | RubberDandelionOmics

Gene overview

TkA08G213620

Reference: TK1151 Chr: Chr08 Coordinates: 55887427-55890353 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1254 bp · TkA08G213620|TK1151|cDNA

AGCATAAGTCTTGTTACACAAGTATCTTGCCATCTACGCGTTTATTCTATATAACATATCCTTTCATTCCCTTCATTTTCCCTCTTTCTAAACCCAAACTCGTCACTTTTTTTCTTCATTTCTGCATAAATCACCTTCGTCGGAGATAAAGATTCAACATAGCTTACACTTCCGATCGACCTATCAACTAGTTGATTTCCAGAAGTGACATAAACTAATTGATTTCTGATAGTTTTTTTTTGTAAACATGTACATGGAAA...

CDS

Download CDS FASTA

744 bp · TkA08G213620|TK1151|CDS

ATGTACATGGAAAGATCAGACATGGTGGAAAACGTAAACGACGAAGGAGACGATGCAGTGATCGGACTTCCTCCTGGATTCCGATTTCATCCAACTGATGAAGAAATCGTCACTCATTATCTAACACCTAAAGTTCTCAACCGGAGGTTCACCGCTAGTGCAATCGGAGAAGCTGATCTTAACAAGTCCGAGCCATGGGATCTACCAAAGAAAGCTAAGATGGGAGAGAAGGAATGGTTCTTCTTTTGTCAGAGAGATCG...

Protein

Download Protein FASTA

247 aa · TkA08G213620|TK1151|PROTEIN

MYMERSDMVENVNDEGDDAVIGLPPGFRFHPTDEEIVTHYLTPKVLNRRFTASAIGEADLNKSEPWDLPKKAKMGEKEWFFFCQRDRKYPTGTRTNRATESGYWKATGKDREIFRPAGNLVGMKKTLVFYIGRAPKGEKTNWVIHEFRLEGKFSYYNMATPSHSQDEWVVSRVFHKNTGAQKNPITDTRLTNYSFVEDILDGPSILPPLLDHSALHVDRSFDREPFYFSHGHEGTSSFSDLDPLLDY

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G213620`
TK1151 ID	TkA08G213620
OH-1004 ID	LXL04_004734
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	68.300
Protein coverage (%)	TK1151 87.449 / OH-1004 53.598 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G213620

Location Chr08:55887427-55890353 (+)

Description Similar to NAC087: NAC domain-containing protein 87

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g04060`	Transcriptional activator that acts as a positive regulator of leaf senescence.	No verified direct reference in this release
`At5g18270`	Binds to the promoter regions of genes involved in chlorophyll catabolic processes, such as NYC1, SGR1, SGR2 and PAO.	No verified direct reference in this release
`At5g07680`	NAC domain-containing protein 79.	No verified direct reference in this release
`At5g61430`	Binds to the promoter regions of genes involved in chlorophyll catabolic processes, such as NYC1, SGR1, SGR2 and PAO.	No verified direct reference in this release
`At5g39610`	Transcription activator that binds to DNA in promoters of target genes on a specific bipartite motif 5'-[ACG][CA]GT[AG](5-6n)[CT]AC[AG]-3'.	The delayed leaf senescence mutants of Arabidopsis, ore1, ore3, and ore9 are tolerant to oxidative stress.2004 · DOI: 10.1093/pcp/pch110 Trifurcate feed-forward regulation of age-dependent cell death involving miR164 in Arabidopsis.2009 · DOI: 10.1126/science.1166386 Forward and reverse genetics to identify genes involved in the age-related resistance response in Arabidopsis thaliana.2009 · DOI: 10.1111/j.1364-3703.2009.00557.x A gene regulatory network controlled by the NAC transcription factor ANAC092/AtNAC2/ORE1 during salt-promoted senescence.2010 · DOI: 10.1111/j.1365-313x.2010.04151.x ORS1, an H₂O₂-responsive NAC transcription factor, controls senescence in Arabidopsis thaliana.2011 · DOI: 10.1093/mp/ssq080 NAC transcription factor ORE1 and senescence-induced BIFUNCTIONAL NUCLEASE1 (BFN1) constitute a regulatory cascade in Arabidopsis.2013 · DOI: 10.1093/mp/sst012 ORE1 balances leaf senescence against maintenance by antagonizing G2-like-mediated transcription.2013 · DOI: 10.1038/embor.2013.24

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_004734 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006979 response to oxidative stress Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009723 response to ethylene Biological Process

GO:0009733 response to auxin Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0010029 regulation of seed germination Biological Process

GO:0010150 leaf senescence Biological Process

GO:0010468 regulation of gene expression Biological Process

GO:0042542 response to hydrogen peroxide Biological Process

GO:0043068 positive regulation of programmed cell death Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

KEGG gene cross-reference

ath:AT3G04060

ath:AT5G07680

ath:AT5G18270

ath:AT5G39610

ath:AT5G61430

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.915

Rank 1 · TkA08G213620 · TK1151

Cytoplasm0.139

Rank 2 · TkA08G213620 · TK1151

Cell membrane0.054

Rank 3 · TkA08G213620 · TK1151

Endoplasmic reticulum0.050

Rank 4 · TkA08G213620 · TK1151

Plastid0.018

Rank 5 · TkA08G213620 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF26493DUF816114-47 aa

PF02365NAM24-149 aa

PF26493DUF8161140-152 aa

PF26493DUF8161159-183 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G213620	`PF26493`	DUF8161	14	47	0.038	14.4
TkA08G213620	`PF02365`	NAM	24	149	2.8e-49	167.4
TkA08G213620	`PF26493`	DUF8161	140	152	0.038	14.4
TkA08G213620	`PF26493`	DUF8161	159	183	0.038	14.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SQQ6`	Arabidopsis thaliana	sp\|Q9SQQ6\|NAC46_ARATH NAC domain-containing protein 46	69.600%	Swiss-Prot	High
`Q9FK44`	Arabidopsis thaliana	sp\|Q9FK44\|NAC87_ARATH NAC domain-containing protein 87	68.300%	Swiss-Prot	High
`Q9FLR3`	Arabidopsis thaliana	sp\|Q9FLR3\|NAC79_ARATH NAC domain-containing protein 79	64.600%	Swiss-Prot	High
`Q9FLJ2`	Arabidopsis thaliana	sp\|Q9FLJ2\|NC100_ARATH NAC domain-containing protein 100	66.500%	Swiss-Prot	High
`Q9FKA0`	Arabidopsis thaliana	sp\|Q9FKA0\|NAC92_ARATH NAC domain-containing protein 92	55.400%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card