Gene Card
Gene overview
cDNA / CDS / Protein Sequences
2473 bp · TkA08G200490|TK1151|cDNA
CTTATCCACATTTTATTTTATCATTTTAGCATTGTACATAATGATATAACAGTAGACGTTAATTTCCTTGTTAATGGCACTCTCGGCTGTAGCAGCTGCCGTCACTACCACCAGTCGTCGCCCAATTCTATCACCATCGTATGCAAGCAACCTCACTACCACTTTTACTCTACTATTAATCAGAAAACACTCTCCTCATCACTCTCGGAAGCTGTTGACAGCAATGGCGGCTTCTTCAACGCCTCCACTGGAGCAAAAAA...
2178 bp · TkA08G200490|TK1151|CDS
ATGGCACTCTCGGCTGTAGCAGCTGCCGTCACTACCACCAGTCGTCGCCCAATTCTATCACCATCGTATGCAAGCAACCTCACTACCACTTTTACTCTACTATTAATCAGAAAACACTCTCCTCATCACTCTCGGAAGCTGTTGACAGCAATGGCGGCTTCTTCAACGCCTCCACTGGAGCAAAAAATCACCGCACCATACGGTTCCTGGTCATCTCCCATCACCTCCGACGTCGTATCAGGAGCCTCCAAGGGCCTCGG...
Protein
Download Protein FASTA725 aa · TkA08G200490|TK1151|PROTEIN
MALSAVAAAVTTTSRRPILSPSYASNLTTTFTLLLIRKHSPHHSRKLLTAMAASSTPPLEQKITAPYGSWSSPITSDVVSGASKGLGGTAVDSHGRLFWLESRPTESGRLVIVKGGNNENEEAIDVTPKEFSVRTVAQEYGGGAFSISGDTLVFSNYKDQRLYKQSLDSKDSTPVPLTPDYGGPQVSYADGVYDTSLNRFITVREDRRESSLDSVTSIVSIQLNDKAVQEPKVLVSGNDFYAFPRLDPAGKRLAWIEWSH...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA08G200490 |
|---|---|
| TK1151 ID | TkA08G200490 |
| OH-1004 ID | LXL04_004913 |
| Relationship / confidence | Multi Source To Oh1004 / Complex relationship |
| Protein identity (%) | 77.400 |
| Protein coverage (%) | TK1151 92.690 / OH-1004 92.403Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA08G200490 |
|---|---|
| Location | Chr08:52341348-52345674 (+) |
| Description | Similar to dapb3: Dipeptidyl aminopeptidase BIII |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0006508 proteolysis Biological Process GO:0050435 amyloid-beta metabolic process Biological Process GO:0051603 proteolysis involved in protein catabolic process Biological Process GO:0005829 cytosol Cellular Component GO:0005886 plasma membrane Cellular Component GO:0004175 endopeptidase activity Molecular Function GO:0004177 aminopeptidase activity Molecular Function GO:0004252 serine-type endopeptidase activity Molecular Function GO:0008236 serine-type peptidase activity Molecular Function GO:0008239 dipeptidyl-peptidase activity Molecular Function GO:0008242 omega peptidase activity Molecular Function GO:0042802 identical protein binding Molecular Function |
| KEGG gene cross-reference | bsu:BSU32230 cel:CELE_F44B9.1 rno:24206 ure:UREG_02301 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF07676PD4010-26 aaPF07676PD40141-170 aaPF07676PD40219-260 aaPF07676PD40299-356 aaPF00326Peptidase_S9436-492 aaPF08386Abhydrolase_4479-532 aaPF05448AXE1485-532 aaPF02129Peptidase_S15501-603 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA08G200490 | PF07676 | PD40 | 10 | 26 | 0.17 | 11.7 |
| TkA08G200490 | PF07676 | PD40 | 141 | 170 | 0.17 | 11.7 |
| TkA08G200490 | PF07676 | PD40 | 219 | 260 | 0.17 | 11.7 |
| TkA08G200490 | PF07676 | PD40 | 299 | 356 | 0.17 | 11.7 |
| TkA08G200490 | PF00326 | Peptidase_S9 | 436 | 492 | 2.2e-47 | 162.1 |
| TkA08G200490 | PF08386 | Abhydrolase_4 | 479 | 532 | 0.047 | 14.5 |
| TkA08G200490 | PF05448 | AXE1 | 485 | 532 | 0.00029 | 20.5 |
| TkA08G200490 | PF02129 | Peptidase_S15 | 501 | 603 | 0.00061 | 20.3 |
| TkA08G200490 | PF00326 | Peptidase_S9 | 508 | 708 | 2.2e-47 | 162.1 |
| TkA08G200490 | PF20434 | BD-FAE | 548 | 667 | 2.8e-10 | 40.8 |
| TkA08G200490 | PF07859 | Abhydrolase_3 | 548 | 686 | 3.6e-05 | 24.3 |
| TkA08G200490 | PF05448 | AXE1 | 558 | 694 | 0.00029 | 20.5 |
| TkA08G200490 | PF01738 | DLH | 562 | 692 | 3.9e-09 | 37.1 |
| TkA08G200490 | PF12146 | Hydrolase_4 | 565 | 587 | 0.0011 | 19.0 |
| TkA08G200490 | PF02129 | Peptidase_S15 | 630 | 671 | 0.00061 | 20.3 |
| TkA08G200490 | PF12146 | Hydrolase_4 | 638 | 684 | 0.0011 | 19.0 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.