LXL04_004913 | RubberDandelionOmics

Gene overview

LXL04_004913

Reference: OH-1004 Chr: Chr01 Coordinates: 150044364-150049011 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2175 bp · LXL04_004913|LXL04_004913|OH1004|cDNA

ATGGACAAATTACTAATACTTCATGATAATCTTAAATCACTACTTACTTCCAAGAATATGATCGACTGTAGGGCCCTAGCGCCGCCGCATTTGGTCCCCAACATTCTTATCGACTCATCGGTCAACTTTACCACCACCCTTGTACTCTTCTACAACATCCCAATGTCTGCTTCTCCACCACCGCAGCAAAAAATCACCGCATCCTACGGTTCCTGGTCGTCCCCAATCACCTCCGACATCGTTTCCGGCGCTGGCAAGAC...

CDS

Download CDS FASTA

2175 bp · LXL04_004913|LXL04_004913|OH1004|CDS

ATGGACAAATTACTAATACTTCATGATAATCTTAAATCACTACTTACTTCCAAGAATATGATCGACTGTAGGGCCCTAGCGCCGCCGCATTTGGTCCCCAACATTCTTATCGACTCATCGGTCAACTTTACCACCACCCTTGTACTCTTCTACAACATCCCAATGTCTGCTTCTCCACCACCGCAGCAAAAAATCACCGCATCCTACGGTTCCTGGTCGTCCCCAATCACCTCCGACATCGTTTCCGGCGCTGGCAAGAC...

Protein

Download Protein FASTA

724 aa · LXL04_004913|LXL04_004913|OH1004|PROTEIN

MDKLLILHDNLKSLLTSKNMIDCRALAPPHLVPNILIDSSVNFTTTLVLFYNIPMSASPPPQQKITASYGSWSSPITSDIVSGAGKTLGGTAVDSLGRLILLESRPTESGRSVLVRGGDNDDEATDITPPEFSVRTVAQDYGGGDFSVSGETVIFSNYKDQRLYKQSIGSPPVAITPDYGEPLVCYADGVFDKRFNRYVTIREDRRESSKNSVATIVSIELNDGIIQDPKVLVGGNDFYAFPRLDHEGKRMAWIEWAHPN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_004913`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_004913`
Location	Chr01:150044364-150049011 (-)
Description	Similar to dapb3: Dipeptidyl aminopeptidase BIII
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_004913` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0006508 proteolysis Biological Process GO:0050435 amyloid-beta metabolic process Biological Process GO:0051603 proteolysis involved in protein catabolic process Biological Process GO:0005829 cytosol Cellular Component GO:0005886 plasma membrane Cellular Component GO:0004175 endopeptidase activity Molecular Function GO:0004177 aminopeptidase activity Molecular Function GO:0004252 serine-type endopeptidase activity Molecular Function GO:0008236 serine-type peptidase activity Molecular Function GO:0008239 dipeptidyl-peptidase activity Molecular Function GO:0008242 omega peptidase activity Molecular Function GO:0042802 identical protein binding Molecular Function
KEGG gene cross-reference	bsu:BSU32230 cel:CELE_F44B9.1 rno:24206 ure:UREG_02301 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.730

Rank 1 · LXL04_004913 · OH-1004

Nucleus0.277

Rank 2 · LXL04_004913 · OH-1004

Peroxisome0.099

Rank 3 · LXL04_004913 · OH-1004

Mitochondrion0.077

Rank 4 · LXL04_004913 · OH-1004

Plastid0.045

Rank 5 · LXL04_004913 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00326.28Peptidase_S9507-707 aa

PF20434.6BD-FAE544-666 aa

PF01738.25DLH555-691 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_004913	`PF00326.28`	Peptidase_S9	507	707	6.5e-44	150.7
LXL04_004913	`PF20434.6`	BD-FAE	544	666	8e-09	36.0
LXL04_004913	`PF01738.25`	DLH	555	691	6.1e-10	39.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card