TkA08G198500 | RubberDandelionOmics

Gene overview

TkA08G198500

Reference: TK1151 Chr: Chr08 Coordinates: 51771423-51773525 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1490 bp · TkA08G198500|TK1151|cDNA

CAAATCAACTGCCCCATCAAAATCCTTGAGATAAATTTACTATTATATCCCTGTCAGCCCCAGAAACATATAAATCCACCATACTTATTTCCATTTTTATCATCCTCCACCTTTTACCCCTCTCCATCTCACCTCAACTCCCAATTCTGTCTTGTTTTCCGATTATTTACAGTCATGGGATCATCAGAAAGACCGAAGAAGAAAGTCCAGTTATGGAAGAAAGCCACAGTCCATTTCTTGTTATGTTTCATTCTCGGTTT...

CDS

Download CDS FASTA

1233 bp · TkA08G198500|TK1151|CDS

CAAATCAACTGCCCCATCAAAATCCTTGAGATAAATTTACTATTATATCCCTGTCAGCCCCAGAAACATATAAATCCACCATACTTATTTCCATTTTTATCATCCTCCACCTTTTACCCCTCTCCATCTCACCTCAACTCCCAATTCTGTCTTGTTTTCCGATTATTTACAGTCATGGGATCATCAGAAAGACCGAAGAAGAAAGTCCAGTTATGGAAGAAAGCCACAGTCCATTTCTTGTTATGTTTCATTCTCGGTTT...

Protein

Download Protein FASTA

410 aa · TkA08G198500|TK1151|PROTEIN

QINCPIKILEINLLLYPCQPQKHINPPYLFPFLSSSTFYPSPSHLNSQFCLVFRLFTVMGSSERPKKKVQLWKKATVHFLLCFILGFFTGFSPTNKSSFPPNDNVIASKDSQEISPPPKVIPNEISKQENGNFDRSMMDESLSMKVQERPNLGPIEEEGKNAILTQEKGETETLTPRRLVIIVTPTSDKDELRGVLLRKMANTLALVPPPLLWVVVESQSESDEVSDILRKTNVMYRHLVFKENFTDVEVEMDHQRNVAL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G198500`
TK1151 ID	TkA08G198500
OH-1004 ID	LXL04_032697
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 85.854 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G198500

Location Chr08:51771423-51773525 (+)

Description Similar to IRX9: Beta-1,4-xylosyltransferase IRX9

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g37090`	Involved in the synthesis of the hemicellulose glucuronoxylan, a major component of secondary cell walls.	Development and application of a suite of polysaccharide-degrading enzymes for analyzing plant cell walls.2006 · DOI: 10.1073/pnas.0604632103 Arabidopsis irregular xylem8 and irregular xylem9: implications for the complexity of glucuronoxylan biosynthesis.2007 · DOI: 10.1105/tpc.106.049320 The irregular xylem9 mutant is deficient in xylan xylosyltransferase activity.2007 · DOI: 10.1093/pcp/pcm135 Comparison of five xylan synthesis mutants reveals new insight into the mechanisms of xylan synthesis.2007 · DOI: 10.1111/j.1365-313x.2007.03307.x The Arabidopsis family GT43 glycosyltransferases form two functionally nonredundant groups essential for the elongation of glucuronoxylan backbone.2010 · DOI: 10.1104/pp.110.155309 Analysis of the Arabidopsis IRX9/IRX9-L and IRX14/IRX14-L pairs of glycosyltransferase genes reveals critical contributions to biosynthesis of the hemicellulose glucuronoxylan.2010 · DOI: 10.1104/pp.110.154971 Arabidopsis family GT43 members are xylan xylosyltransferases required for the elongation of the xylan backbone.2012 · DOI: 10.1093/pcp/pcr158 Site-directed mutagenesis of IRX9, IRX9L and IRX14 proteins involved in xylan biosynthesis: glycosyltransferase activity is not required for IRX9 function in Arabidopsis.2014 · DOI: 10.1371/journal.pone.0105014
`At1g27600`	Involved in the synthesis of the hemicellulose glucuronoxylan, a major component of secondary cell walls.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0123100`	Probable beta-1,4-xylosyltransferase involved in xylan biosynthesis in cell walls.	Functional roles of rice glycosyltransferase family GT43 in xylan biosynthesis.2014 · DOI: 10.4161/psb.27809
`Os03g0287800`	Involved in the synthesis of glucuronoxylan hemicellulose in secondary cell walls.	No verified direct reference in this release
`Os01g0675500`	Probable beta-1,4-xylosyltransferase involved in xylan biosynthesis in cell walls.	Three Novel Rice Genes Closely Related to the Arabidopsis IRX9, IRX9L, and IRX14 Genes and Their Roles in Xylan Biosynthesis.2013 · DOI: 10.3389/fpls.2013.00083

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032697 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009834 plant-type secondary cell wall biogenesis Biological Process

GO:0010413 glucuronoxylan metabolic process Biological Process

GO:0010417 glucuronoxylan biosynthetic process Biological Process

GO:0010584 pollen exine formation Biological Process

GO:0045492 xylan biosynthetic process Biological Process

GO:0071555 cell wall organization Biological Process

GO:0000139 Golgi membrane Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0015018 galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity Molecular Function

GO:0042285 xylosyltransferase activity Molecular Function

GO:0047517 1,4-beta-D-xylan synthase activity Molecular Function

KEGG gene cross-reference

ath:AT1G27600

ath:AT2G37090

dosa:Os01g0675500

dosa:Os03g0287800

dosa:Os05g0123100

osa:4325514

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.789

Rank 1 · TkA08G198500 · TK1151

Endoplasmic reticulum0.079

Rank 2 · TkA08G198500 · TK1151

Cell membrane0.062

Rank 3 · TkA08G198500 · TK1151

Extracellular0.050

Rank 4 · TkA08G198500 · TK1151

Cytoplasm0.049

Rank 5 · TkA08G198500 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03360Glyco_transf_43200-405 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G198500	`PF03360`	Glyco_transf_43	200	405	7.9e-55	186.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZQC6`	Arabidopsis thaliana	sp\|Q9ZQC6\|IRX9_ARATH Beta-1,4-xylosyltransferase IRX9	53.100%	Swiss-Prot	High
`Q9SXC4`	Arabidopsis thaliana	sp\|Q9SXC4\|IRX9H_ARATH Probable beta-1,4-xylosyltransferase IRX9H	36.300%	Swiss-Prot	Medium
`Q75L84`	Oryza sativa subsp. japonica	sp\|Q75L84\|GT43A_ORYSJ Probable beta-1,4-xylosyltransferase GT43A	39.800%	Swiss-Prot	Medium
`Q10N05`	Oryza sativa subsp. japonica	sp\|Q10N05\|GT32_ORYSJ Probable glucuronosyltransferase Os03g0287800	38.300%	Swiss-Prot	Medium
`Q5QM25`	Oryza sativa subsp. japonica	sp\|Q5QM25\|IRX9L_ORYSJ Probable beta-1,4-xylosyltransferase IRX9L	33.200%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card