TkA08G170980 | RubberDandelionOmics

Gene overview

TkA08G170980

Reference: TK1151 Chr: Chr08 Coordinates: 44746939-44748994 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1631 bp · TkA08G170980|TK1151|cDNA

CCTAGCACCAAATATTTAGGAGATTTGAAAATACTTGGAAATGCAATCCATTGAACTGAGATTTGAGCCTCTTGTTATTGATGACAAATTAGGCATAAGTTATATGTAAACAACGGCTCACGTTTTTAGGCCATGTTGAGATATTTGCTATGTTGATACGATCTGGTATTCGTCTCCAGCTTCAAGTTGTGAGAGAGGGTTAATCCATGGAACAATCATTTGATTGTGTGTCGTTTTAATTCAGTTTCATCTTCTTCTTC...

CDS

Download CDS FASTA

972 bp · TkA08G170980|TK1151|CDS

ATGTGCAGGTTTAATAAAGTAGCAGAGATCTTAGATATTTCAAATCTAAATATCCGAATAAAGATAAAACCTCAATTTTTATCCCCTGAAGTCCATTATGGCGCTCATCTTGTGTTTAGATTTTGTGGTCCAAGAAAATCTTTAGCTAAACGGATGTATGTGAACCTTAAGTATAGAATGGGGGGTGAAACCTTACATGCATATTTCGCAACAAGAAGAGAAGATGAGTGGATGATGATTGAATTATACCGATTCTTAAA...

Protein

Download Protein FASTA

323 aa · TkA08G170980|TK1151|PROTEIN

MCRFNKVAEILDISNLNIRIKIKPQFLSPEVHYGAHLVFRFCGPRKSLAKRMYVNLKYRMGGETLHAYFATRREDEWMMIELYRFLNNKKDIDSELLLESLSRCYSENRAIYIEGIEFRAIDNVKHEIEESKANQQLLKSDMNVDEGEKLFSHKKKHYILLAKEALYESSNVQLFNSIPSNESGFQEVIELLRQQVFRIKCKIEGQKLSKDTEYACYLVFKLSQNCHGLHCPVIVRDLLQRKKNKEKGIIYFRSPNPCNV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G170980`
TK1151 ID	TkA08G170980
OH-1004 ID	LXL04_032394
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	92.200
Protein coverage (%)	TK1151 99.381 / OH-1004 23.312 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G170980

Location Chr08:44746939-44748994 (+)

Description Similar to At5g59700: Probable receptor-like protein kinase At5g59700

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g09155`	F-box protein PP2-B15.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032394 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0010183 pollen tube guidance Biological Process

GO:0010483 pollen tube reception Biological Process

GO:0051924 regulation of calcium ion transport Biological Process

GO:0080147 root hair cell development Biological Process

GO:0097275 intracellular ammonium homeostasis Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009705 plant-type vacuole membrane Cellular Component

GO:0043680 filiform apparatus Cellular Component

GO:0004672 protein kinase activity Molecular Function

KEGG gene cross-reference

ath:AT5G59700

ath:AT5G61350

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.517

Rank 1 · TkA08G170980 · TK1151

Cytoplasm0.447

Rank 2 · TkA08G170980 · TK1151

Cell membrane0.109

Rank 3 · TkA08G170980 · TK1151

Endoplasmic reticulum0.074

Rank 4 · TkA08G170980 · TK1151

Extracellular0.057

Rank 5 · TkA08G170980 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14299PP23-119 aa

PF04616Glyco_hydro_4381-173 aa

PF14299PP2156-318 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G170980	`PF14299`	PP2	3	119	2.2e-37	129.0
TkA08G170980	`PF04616`	Glyco_hydro_43	81	173	0.35	10.9
TkA08G170980	`PF14299`	PP2	156	318	2.2e-37	129.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O80494`	Arabidopsis thaliana	sp\|O80494\|P2B15_ARATH F-box protein PP2-B15	23.300%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card