TkA08G160990 | RubberDandelionOmics

Gene overview

TkA08G160990

Reference: TK1151 Chr: Chr08 Coordinates: 42002424-42004579 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1341 bp · TkA08G160990|TK1151|cDNA

ATAGTCATTAATTAATAATGAATAAAGACAAAAAAGTAATAATTTGTCGTCGTTATTCATGTTGATCAAATCCAGGTCTTTCTGGTGATCTCCTTGCCTCCTTTTCACAGGGCTCCCAATCTTCATCGGCCGCCAATTCTTAAAACTCGGTTCACCCCTACGATCCCCGAATGTCTGCAGATAACTCAATCATTCCTTGAAACCTAGGATTTGAAATGGTACATAGAAGAAACCTCTCTGCAAATTGTACTTCGATCCAA...

CDS

Download CDS FASTA

780 bp · TkA08G160990|TK1151|CDS

ATGCAATTAATGTCAAATGACAATCCAAACGGACGCTCTTCAGAAACAGAACCAATATTAAACGAATCCAGATGTGCTGAAGAAGCCGACAATCATTCATCTACATTTGAAATAAGAACCGAAGGTAGCAGTGACTGTTCCATATCTGTTGAAGACTCACAAACCTCCGAAGCCAATGAAAACACCAGTCTCGTAGCTTCAGACCAACCACAGTGCCGCATATGCCTTGATACAGAAGGGGACGATCTGATTGCACCCTG...

Protein

Download Protein FASTA

259 aa · TkA08G160990|TK1151|PROTEIN

MQLMSNDNPNGRSSETEPILNESRCAEEADNHSSTFEIRTEGSSDCSISVEDSQTSEANENTSLVASDQPQCRICLDTEGDDLIAPCHCRGTQKYVHRSCLDNWRSTREGFAFSHCTECRAVFILRANVPPDRWWLRLKFQLLVARDHAFIFVIVQLIVAVLGVLVYKFYGDELREMFGYEEHPYGFYTMAVLAIVLVGLLYGFFIAIICGQRINERHYHILAKQELTKEYIVEDREVNKDVKELDPSHVTELRMLGLY

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G160990`
TK1151 ID	TkA08G160990
OH-1004 ID	LXL04_032244
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA08G160990`
Location	Chr08:42002424-42004579 (+)
Description	Similar to Marchf8: E3 ubiquitin-protein ligase MARCHF8
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_032244` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000209 protein polyubiquitination Biological Process GO:0002495 antigen processing and presentation of peptide antigen via MHC class II Biological Process GO:0006955 immune response Biological Process GO:0016567 protein ubiquitination Biological Process GO:0043161 proteasome-mediated ubiquitin-dependent protein catabolic process Biological Process GO:0045347 negative regulation of MHC class II biosynthetic process Biological Process GO:0000139 Golgi membrane Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005764 lysosome Cellular Component GO:0005765 lysosomal membrane Cellular Component GO:0005768 endosome Cellular Component GO:0005789 endoplasmic reticulum membrane Cellular Component
KEGG gene cross-reference	bta:540667 hsa:220972 mmu:71779 xla:495072 xtr:448095 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.308

Rank 1 · TkA08G160990 · TK1151

Golgi apparatus0.300

Rank 2 · TkA08G160990 · TK1151

Endoplasmic reticulum0.280

Rank 3 · TkA08G160990 · TK1151

Lysosome / Vacuole0.210

Rank 4 · TkA08G160990 · TK1151

Cell membrane0.200

Rank 5 · TkA08G160990 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12906RINGv18-26 aa

PF13920zf-C3HC4_369-120 aa

PF13639zf-RING_271-120 aa

PF12906RINGv72-119 aa

PF18303Saf_2TM133-209 aa

PF02687FtsX142-214 aa

PF06836DUF1240150-220 aa

PF13639zf-RING_2209-217 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G160990	`PF12906`	RINGv	18	26	7.7e-11	42.7
TkA08G160990	`PF13920`	zf-C3HC4_3	69	120	5.3	7.6
TkA08G160990	`PF13639`	zf-RING_2	71	120	1.5	9.9
TkA08G160990	`PF12906`	RINGv	72	119	7.7e-11	42.7
TkA08G160990	`PF18303`	Saf_2TM	133	209	0.2	12.0
TkA08G160990	`PF02687`	FtsX	142	214	0.0021	18.8
TkA08G160990	`PF06836`	DUF1240	150	220	0.27	12.5
TkA08G160990	`PF13639`	zf-RING_2	209	217	1.5	9.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card