TkA08G148660 | RubberDandelionOmics

Gene overview

TkA08G148660

Reference: TK1151 Chr: Chr08 Coordinates: 38710131-38714513 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3028 bp · TkA08G148660|TK1151|cDNA

AATGCCTCGTCACCTTAAAATAATTGAAGTAATTTATAAAGCAGATTAGATTGCAGGTTGGGTTTCATCAGTCAGTTGGGGCTACATCTTTCACTGATTGGCTTCTCCATTCTATCGTTACATTGCTCAAGGGTTTTTGATCGGATTCAACTGTTTGGAAGTGACTTCAGTTCAAATTCTGCGTTTAACTGATAAGCAGCACTTGATCTTCACAAACGATGGTAGTTTTTGTTGATGCGGATTTTGAACAGATCTGAGAC...

CDS

Download CDS FASTA

1305 bp · TkA08G148660|TK1151|CDS

ATGGCTCAGATACTGCTTCATGGCACTCTTCATGCGACGATCTACGAAGTTGATAAGCTTAAAATTAGTGGAAGCGGCAATATACTCTCGAAGATTGTGGCTAACATAGAGGAGGCTGTTGGAGTCGGGAAAGGAACCCCCAAAATTTACGCAACAATCGATCTAGAAAAAGCCAGAGTTGGACGCACCAGGAAGATTGAGAAGGAGGTCGAGAGCCCAAGATGGTACGAGTCCTTCCACATTTACTGTGCTCACCATGC...

Protein

Download Protein FASTA

434 aa · TkA08G148660|TK1151|PROTEIN

MAQILLHGTLHATIYEVDKLKISGSGNILSKIVANIEEAVGVGKGTPKIYATIDLEKARVGRTRKIEKEVESPRWYESFHIYCAHHASDVIFTVKDDNPIGATLIGRAYVPVQELLSGDEINRWVEILDTDKKPIKAGSKIRVKLQYFDVTRDRNWAHGIKSSKYPGVPYTFFSQRQGCRVSLYQDAHVPDNFIPKIPLAGGKSYEPHRCWEDIFDAITNAKHFIYITGWSVYAEITLIRDSRRPKEGGDVTLGDLLKKK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G148660`
TK1151 ID	TkA08G148660
OH-1004 ID	LXL04_002011
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	78.500
Protein coverage (%)	TK1151 81.567 / OH-1004 46.579 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G148660

Location Chr08:38710131-38714513 (-)

Description No functional description available

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g15730`	Hydrolyzes glycerol-phospholipids at the terminal phosphodiesteric bond to generate phosphatidic acids (PA).	Arabidopsis phospholipase Dalpha1 interacts with the heterotrimeric G-protein alpha-subunit through a motif analogous to the DRY motif in G-protein-coupled receptors.2004 · DOI: 10.1074/jbc.m309529200 A bifurcating pathway directs abscisic acid effects on stomatal closure and opening in Arabidopsis.2006 · DOI: 10.1126/science.1123769 Suppression of phospholipase Dalpha1 induces freezing tolerance in Arabidopsis: response of cold-responsive genes and osmolyte accumulation.2006 · DOI: 10.1016/j.jplph.2005.08.006 Early PLDalpha-mediated events in response to progressive drought stress in Arabidopsis: a transcriptome analysis.2007 · DOI: 10.1093/jxb/erl262 Enhancing seed quality and viability by suppressing phospholipase D in Arabidopsis.2007 · DOI: 10.1111/j.1365-313x.2007.03103.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_002011 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009395 phospholipid catabolic process Biological Process

GO:0016042 lipid catabolic process Biological Process

GO:0034638 phosphatidylcholine catabolic process Biological Process

GO:0046470 phosphatidylcholine metabolic process Biological Process

GO:0005773 vacuole Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009536 plastid Cellular Component

GO:0004630 D-type glycerophospholipase activity Molecular Function

GO:0005509 calcium ion binding Molecular Function

KEGG gene cross-reference

nta:107779725

rcu:8282326

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.423

Rank 1 · TkA08G148660 · TK1151

Cell membrane0.317

Rank 2 · TkA08G148660 · TK1151

Nucleus0.183

Rank 3 · TkA08G148660 · TK1151

Lysosome / Vacuole0.162

Rank 4 · TkA08G148660 · TK1151

Endoplasmic reticulum0.147

Rank 5 · TkA08G148660 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00168C243-126 aa

PF00614PLDc217-402 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G148660	`PF00168`	C2	43	126	9.9e-10	39.3
TkA08G148660	`PF00614`	PLDc	217	402	7.6e-64	216.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q38882`	Arabidopsis thaliana	sp\|Q38882\|PLDA1_ARATH Phospholipase D alpha 1	76.500%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card