TkA08G138920 | RubberDandelionOmics

Gene overview

TkA08G138920

Reference: TK1151 Chr: Chr08 Coordinates: 36139033-36141207 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1647 bp · TkA08G138920|TK1151|cDNA

CTTGTACATTTTGAAACAATTTTAGAATTACCAAAAAGTCCAGCTAAGTTTGTAATCATATCATCGCCCACCCCAAATGTAACGTCCGTATCTCACTCTCTTTCTCTCTCTCTCTCTCTAAAAAGCCATTGCCCTTTCCCTCTGCAACTTCACCACCATCTCTATATCTTTTTCCTCTCTCTCTCTCTCTCTAAACCTTCTATTCAGTATTCACCACCATGAACGAAAGCAATGAAGGAAATGAATTCAACCATTTGAAT...

CDS

Download CDS FASTA

1257 bp · TkA08G138920|TK1151|CDS

ATGAACGAAAGCAATGAAGGAAATGAATTCAACCATTTGAATTCGTTTAAAGCTTTGTTAGAAGTTGAAGAAGACAACAACAACAATTGGTATTTACAGAACCATAATCACCATGAAAACAACCTCGATTTTTCCCCTAATTCACCTTCGCTTTTCCAGAACTTCGACCCAACCCATGCCCAATACTTTTTACCTCCAAAAGCCACCGTATCTGACAACCCGTTAGACGCCAGTTACGATATCGAAGCTGGTTTTCTTGC...

Protein

Download Protein FASTA

418 aa · TkA08G138920|TK1151|PROTEIN

MNESNEGNEFNHLNSFKALLEVEEDNNNNWYLQNHNHHENNLDFSPNSPSLFQNFDPTHAQYFLPPKATVSDNPLDASYDIEAGFLAMHRGHDGLSEFVALGSQTQMVVPNLTSDPHFATTQFGNEYASTGFPSLGPLENLASSGAQPTLFQKRAALRRNSNATNGGGGGNLGVLVDVDNMSFDDSGLNYDSDDLTENTNNNGIQIGGGESSNPNSTASGGGGDRKGKRKGFPAKNLMAERRRRKKLNDRLYLLRSVVPN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G138920`
TK1151 ID	TkA08G138920
OH-1004 ID	LXL04_023708
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	40.500
Protein coverage (%)	TK1151 99.282 / OH-1004 91.513 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G138920

Location Chr08:36139033-36141207 (+)

Description Similar to SCRM: Transcription factor ICE1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g26744`	Transcriptional activator that regulates the cold-induced transcription of CBF/DREB1 genes.	SIZ1-mediated sumoylation of ICE1 controls CBF3/DREB1A expression and freezing tolerance in Arabidopsis.2007 · DOI: 10.1105/tpc.106.048397 SCREAM/ICE1 and SCREAM2 specify three cell-state transitional steps leading to arabidopsis stomatal differentiation.2008 · DOI: 10.1105/tpc.108.060848
`At1g12860`	Mediates stomatal differentiation in the epidermis probably by controlling successive roles of SPCH, MUTE, and FAMA.	SCREAM/ICE1 and SCREAM2 specify three cell-state transitional steps leading to arabidopsis stomatal differentiation.2008 · DOI: 10.1105/tpc.108.060848
`At5g65640`	Transcription factor.	No verified direct reference in this release
`At5g10570`	Transcription factor bHLH61.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os10g0544200`	Probable transcription factor.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_023708 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006952 defense response Biological Process

GO:0009409 response to cold Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009960 endosperm development Biological Process

GO:0010115 regulation of abscisic acid biosynthetic process Biological Process

GO:0010162 seed dormancy process Biological Process

GO:0010371 regulation of gibberellin biosynthetic process Biological Process

GO:0010440 stomatal lineage progression Biological Process

GO:0010444 guard mother cell differentiation Biological Process

GO:0031347 regulation of defense response Biological Process

KEGG gene cross-reference

ath:AT1G12860

ath:AT3G26744

ath:AT5G10570

ath:AT5G65640

dosa:Os03g0135700

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.964

Rank 1 · TkA08G138920 · TK1151

Cytoplasm0.102

Rank 2 · TkA08G138920 · TK1151

Cell membrane0.031

Rank 3 · TkA08G138920 · TK1151

Endoplasmic reticulum0.025

Rank 4 · TkA08G138920 · TK1151

Plastid0.013

Rank 5 · TkA08G138920 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23176bHLH_LHW30-47 aa

PF00010HLH238-280 aa

PF23177bHLH_IRO3239-293 aa

PF23173bHLH_SAC51240-283 aa

PF23176bHLH_LHW242-290 aa

PF22754bHLH-TF_ACT-like_plant336-410 aa

PF26956ACT_ACR_D1350-397 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G138920	`PF23176`	bHLH_LHW	30	47	0.0062	17.2
TkA08G138920	`PF00010`	HLH	238	280	8.8e-10	39.0
TkA08G138920	`PF23177`	bHLH_IRO3	239	293	2.2e-06	28.6
TkA08G138920	`PF23173`	bHLH_SAC51	240	283	1.8e-08	34.9
TkA08G138920	`PF23176`	bHLH_LHW	242	290	0.0062	17.2
TkA08G138920	`PF22754`	bHLH-TF_ACT-like_plant	336	410	2.8e-12	47.3
TkA08G138920	`PF26956`	ACT_ACR_D1	350	397	0.0013	19.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LSE2`	Arabidopsis thaliana	sp\|Q9LSE2\|ICE1_ARATH Transcription factor ICE1	47.900%	Swiss-Prot	Medium
`Q9LPW3`	Arabidopsis thaliana	sp\|Q9LPW3\|SCRM2_ARATH Transcription factor SCREAM2	50.400%	Swiss-Prot	High
`Q9LSL1`	Arabidopsis thaliana	sp\|Q9LSL1\|BH093_ARATH Transcription factor bHLH93	42.500%	Swiss-Prot	Low
`Q9LXA9`	Arabidopsis thaliana	sp\|Q9LXA9\|BH061_ARATH Transcription factor bHLH61	43.700%	Swiss-Prot	Low
`Q336V8`	Oryza sativa subsp. japonica	sp\|Q336V8\|BH004_ORYSJ Basic helix-loop-helix protein 004	44.600%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card