TkA08G137190 | RubberDandelionOmics

Gene overview

TkA08G137190

Reference: TK1151 Chr: Chr08 Coordinates: 35667921-35669891 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1077 bp · TkA08G137190|TK1151|cDNA

GTTTTTTTCTTAATTTTTTTGTTTTTTTAGCTCTCCTTATAAGCAAGAATAGGGTTTCACTTTATCACAGCCGATCGCTCCAACTCAATTCCACTCCACTCACAAGCGAGACCAGCCAGTGGATCTTCTCTTCAGAAGAGTTATACATCAATGGCGCCCACATTTCACGTTGGTTCTGAGGCTGGACTTAAGAAGCTTGATGAGTACCTATTGTCTCGCAGTTACATCACCGGGTATCAAGCTTCAAAGGATGATCTCAC...

CDS

Download CDS FASTA

693 bp · TkA08G137190|TK1151|CDS

ATGGCGCCCACATTTCACGTTGGTTCTGAGGCTGGACTTAAGAAGCTTGATGAGTACCTATTGTCTCGCAGTTACATCACCGGGTATCAAGCTTCAAAGGATGATCTCACTGTTCATGCAGCTTTCACAAAACCCCCATCATCCCAATATGTGAATGTATCTCGTTGGTTCACTCACATTGATGCCCTTTTGAGGATTTCTGGTGTTTCTGCTGAAGGCAGTGGTGTTGTTATTGAAGGATCTGCTTCTGCTCATGAAGA...

Protein

Download Protein FASTA

230 aa · TkA08G137190|TK1151|PROTEIN

MAPTFHVGSEAGLKKLDEYLLSRSYITGYQASKDDLTVHAAFTKPPSSQYVNVSRWFTHIDALLRISGVSAEGSGVVIEGSASAHEEAVATPPAADTKAAADEDDDSDVDLFGEETEEEKKAAEERAAAAKASGKKKESGKSSVLLDVKPWDDETDMQKLEEAVRSVQMEGLLWGASKLVPVGYGIKKLQIMMTIVDDLVSVDTVIEERLTEEPINEYVQSCDIVAFNKI

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G137190`
TK1151 ID	TkA08G137190
OH-1004 ID	LXL04_032532
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	64.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G137190

Location Chr08:35667921-35669891 (+)

Description Similar to At5g12110: Elongation factor 1-beta 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g30230`	EF-1-beta and EF-1-delta stimulate the exchange of GDP bound to EF-1-alpha to GTP.	No verified direct reference in this release
`At2g18110`	EF-1-beta and EF-1-delta stimulate the exchange of GDP bound to EF-1-alpha to GTP.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os07g0614500`	EF-1-beta and EF-1-beta' stimulate the exchange of GDP bound to EF-1-alpha to GTP.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032532 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006414 translational elongation Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005773 vacuole Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005853 eukaryotic translation elongation factor 1 complex Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0009536 plastid Cellular Component

GO:0010494 cytoplasmic stress granule Cellular Component

GO:0048046 apoplast Cellular Component

GO:0003746 translation elongation factor activity Molecular Function

GO:0005085 guanyl-nucleotide exchange factor activity Molecular Function

KEGG gene cross-reference

ath:AT5G12110

ath:AT5G19510

dosa:Os07g0662500

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.861

Rank 1 · TkA08G137190 · TK1151

Nucleus0.278

Rank 2 · TkA08G137190 · TK1151

Endoplasmic reticulum0.076

Rank 3 · TkA08G137190 · TK1151

Mitochondrion0.047

Rank 4 · TkA08G137190 · TK1151

Cell membrane0.047

Rank 5 · TkA08G137190 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF21972Arc1p_N_like10-58 aa

PF27144PA14_3316012-20 aa

PF27144PA14_33160113-142 aa

PF00736EF1_GNE143-230 aa

PF27144PA14_33160155-166 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G137190	`PF21972`	Arc1p_N_like	10	58	0.01	16.9
TkA08G137190	`PF27144`	PA14_33160	12	20	2.6	9.1
TkA08G137190	`PF27144`	PA14_33160	113	142	2.6	9.1
TkA08G137190	`PF00736`	EF1_GNE	143	230	2.2e-32	111.7
TkA08G137190	`PF27144`	PA14_33160	155	166	2.6	9.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P48006`	Arabidopsis thaliana	sp\|P48006\|EF1D1_ARATH Elongation factor 1-delta 1	81.800%	Swiss-Prot	High
`Q9SI20`	Arabidopsis thaliana	sp\|Q9SI20\|EF1D2_ARATH Elongation factor 1-delta 2	81.000%	Swiss-Prot	High
`Q40680`	Oryza sativa subsp. japonica	sp\|Q40680\|EF1D1_ORYSJ Elongation factor 1-delta 1	76.400%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card