Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1198 bp · TkA08G136840|TK1151|cDNA
ACATTTTGTTTATTTCAGTTATTTTAACAAAGTGGTTAAACCTTCGGGGGGCTTTTTGTTTCTCACCCAAATATAAGCCAAAAATGAAAATTTTAACGCTGAAAAAGTTATAAATATGATTTCCATTTAATTCATCTCTACCCTCTCCAGTTTCACTCAAATAGTCAATTCACTCGACGCTTTTCTCCTCTCCTATCCATCTCAGGCGTACACAGACGACTGGAATCTGAACAAACGGTAACGGCCGGAATCAAACCAGT...
636 bp · TkA08G136840|TK1151|CDS
ATGTCATACGCCGGAGGCGGTGTACCCGGACGCGATCCAATGCAAGTCAGTACTGCTCCAAGAAAACCCAGAATTCTTCTCGCAGCATGTGGAAGTGTAGCCGCCATCAAATTCGGTCGCCTCTGCAGCTGTTTCTCCGATTGGGCAGATGTAAAAGCCGTCGCGACGCGGACATCTTTGAATTTCGTCGATCTTGCATCAATTCCCAATAACGTAATGCTTTACACCGATCAACATGAATGGTCGTCATGGTCCAAAAT...
Protein
Download Protein FASTA211 aa · TkA08G136840|TK1151|PROTEIN
MSYAGGGVPGRDPMQVSTAPRKPRILLAACGSVAAIKFGRLCSCFSDWADVKAVATRTSLNFVDLASIPNNVMLYTDQHEWSSWSKIGDSVLHIELRRWADIMIIAPLSANTLAKIAGGLCDNLLTSIVRAWDYEKPIFVAPSMNAFTWKNSFTEKHCETIDELGINLIPPVTTRLASGVDGTSAMVEPSFILSTVRSFLERKKASSSRRA
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA08G136840 |
|---|---|
| TK1151 ID | TkA08G136840 |
| OH-1004 ID | LXL04_031921 |
| Relationship / confidence | Rbh High Identity Coverage Synteny / Strict |
| Protein identity (%) | 99.500 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA08G136840 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr08:35543454-35545070 (-) | |||||||||
| Description | Similar to HAL3B: Probable phosphopantothenoylcysteine decarboxylase | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0009409 response to cold Biological Process GO:0009651 response to salt stress Biological Process GO:0009737 response to abscisic acid Biological Process GO:0010226 response to lithium ion Biological Process GO:0015937 coenzyme A biosynthetic process Biological Process GO:0042538 hyperosmotic salinity response Biological Process GO:0048573 photoperiodism, flowering Biological Process GO:0072708 response to sorbitol Biological Process GO:1901002 positive regulation of response to salt stress Biological Process GO:1902074 response to salt Biological Process GO:2000280 regulation of root development Biological Process GO:0005634 nucleus Cellular Component | |||||||||
| KEGG gene cross-reference | ath:AT1G48605 ath:AT3G18030 gmx:100499989 gmx:100778368 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF02441Flavoprotein17-199 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA08G136840 | PF02441 | Flavoprotein | 17 | 199 | 2.1e-47 | 162.1 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.