TkA08G134140 | RubberDandelionOmics

Gene overview

TkA08G134140

Reference: TK1151 Chr: Chr08 Coordinates: 34864168-34867697 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2049 bp · TkA08G134140|TK1151|cDNA

GTTGACACCTATGTTCTCTTTTGGGACCAAAAAGACCCGGTCACCCCTTGAGATAAGATGGAATTTATACTAAAGAAGACCACCGGCATCACATGACTACGATTTACTTCTTGTAGAAATCGTTCAATATGTATCTCATTTGATAATGCATCCAAAAGCAGGCGCATAGTTTCATCGATCTGTGATTGATTTGCAATGGATCCAAACCCTAAGAACTTTCCAATTCTCTCGTATGTAATGGCCAAACTCCCCAGTGTCAG...

CDS

Download CDS FASTA

1539 bp · TkA08G134140|TK1151|CDS

ATGGATCCAAACCCTAAGAACTTTCCAATTCTCTCGTATGTAATGGCCAAACTCCCCAGTGTCAGCCGGTCTCAGTCACCGGAGTTTGACATTGAACAACCACCGCCGACGGCTCCTTCCACATCCGAACCAGAACCTTACTTCGAACTCACTGAACGGATGCCTTACTTGAGCGATCCTGAACTACTTGCTTCCATGCGTGCAGCTGTCGACGATGTATCTCGGACACGATCTGTACTAAAAACCCTAGGCGAGTGTCC...

Protein

Download Protein FASTA

512 aa · TkA08G134140|TK1151|PROTEIN

MDPNPKNFPILSYVMAKLPSVSRSQSPEFDIEQPPPTAPSTSEPEPYFELTERMPYLSDPELLASMRAAVDDVSRTRSVLKTLGECPDHEFVDIARSRLAEMDKSLSNQLEEVSLSDNDAEEDDKRKEEEREKQSFKAVISLYEMHQSYEKMLSEAEKRLEKLYDAAKKGGKSVAVDDQGCSSESTGVEDDVQDEVVAILNDALTNELARIDLSERRLPFLPEAFGKLRMLVSLKISSNQLQAIPDSIAGLENLEELNAS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G134140`
TK1151 ID	TkA08G134140
OH-1004 ID	LXL04_031881
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G134140

Location Chr08:34864168-34867697 (+)

Description Similar to PIRL1: Plant intracellular Ras-group-related LRR protein 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g05850`	Leucine-rich repeat protein that likely mediates protein interactions, possibly in the context of signal transduction.	PIRL1 and PIRL9, encoding members of a novel plant-specific family of leucine-rich repeat proteins, are essential for differentiation of microspores into pollen.2010 · DOI: 10.1007/s00425-010-1242-6 Effect of sporophytic PIRL9 genotype on post-meiotic expression of the Arabidopsis pirl1;pirl9 mutant pollen phenotype.2011 · DOI: 10.1007/s00425-010-1324-5
`At3g11330`	Leucine-rich repeat protein that likely mediates protein interactions, possibly in the context of signal transduction.	PIRL1 and PIRL9, encoding members of a novel plant-specific family of leucine-rich repeat proteins, are essential for differentiation of microspores into pollen.2010 · DOI: 10.1007/s00425-010-1242-6 Effect of sporophytic PIRL9 genotype on post-meiotic expression of the Arabidopsis pirl1;pirl9 mutant pollen phenotype.2011 · DOI: 10.1007/s00425-010-1324-5
`At1g12970`	Leucine-rich repeat protein that likely mediates protein interactions, possibly in the context of signal transduction.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os04g0476700`	Leucine-rich repeat protein that likely mediates protein interactions, possibly in the context of signal transduction.	No verified direct reference in this release
`Os02g0593600`	Leucine-rich repeat protein that likely mediates protein interactions, possibly in the context of signal transduction.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031881 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009416 response to light stimulus Biological Process

GO:0009555 pollen development Biological Process

GO:0035556 intracellular signal transduction Biological Process

GO:0046777 protein autophosphorylation Biological Process

GO:0055046 microgametogenesis Biological Process

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0004674 protein serine/threonine kinase activity Molecular Function

KEGG gene cross-reference

ath:AT1G12970

ath:AT3G11330

ath:AT5G05850

dosa:Os02g0593600

dosa:Os04g0476700

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.324

Rank 1 · TkA08G134140 · TK1151

Cytoplasm0.280

Rank 2 · TkA08G134140 · TK1151

Nucleus0.274

Rank 3 · TkA08G134140 · TK1151

Endoplasmic reticulum0.095

Rank 4 · TkA08G134140 · TK1151

Golgi apparatus0.085

Rank 5 · TkA08G134140 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25013LRR_Zer-192-112 aa

PF23952LRR_EndoS93-118 aa

PF02827PKI93-135 aa

PF24048LRR_NXF1-5100-119 aa

PF12799LRR_4106-118 aa

PF13855LRR_8108-118 aa

PF00560LRR_1109-118 aa

PF13516LRR_6110-119 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G134140	`PF25013`	LRR_Zer-1	92	112	0.23	12.3
TkA08G134140	`PF23952`	LRR_EndoS	93	118	0.18	12.8
TkA08G134140	`PF02827`	PKI	93	135	2.2	9.3
TkA08G134140	`PF24048`	LRR_NXF1-5	100	119	0.025	14.9
TkA08G134140	`PF12799`	LRR_4	106	118	5.1e-19	68.6
TkA08G134140	`PF13855`	LRR_8	108	118	5.8e-23	81.1
TkA08G134140	`PF00560`	LRR_1	109	118	4.9e-15	53.1
TkA08G134140	`PF13516`	LRR_6	110	119	0.042	14.6
TkA08G134140	`PF02827`	PKI	191	215	2.2	9.3
TkA08G134140	`PF23952`	LRR_EndoS	207	239	0.18	12.8
TkA08G134140	`PF13855`	LRR_8	208	264	5.8e-23	81.1
TkA08G134140	`PF00560`	LRR_1	208	228	4.9e-15	53.1
TkA08G134140	`PF24758`	LRR_At5g56370	212	258	0.0036	17.7
TkA08G134140	`PF23598`	LRR_14	213	260	3.7e-25	89.1
TkA08G134140	`PF23286`	LRR_13	216	255	0.00018	22.0
TkA08G134140	`PF13516`	LRR_6	229	242	0.042	14.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FFJ3`	Arabidopsis thaliana	sp\|Q9FFJ3\|PIRL1_ARATH Plant intracellular Ras-group-related LRR protein 1	62.700%	Swiss-Prot	High
`Q8VYG9`	Arabidopsis thaliana	sp\|Q8VYG9\|PIRL9_ARATH Plant intracellular Ras-group-related LRR protein 9	61.200%	Swiss-Prot	High
`Q8W4Q3`	Arabidopsis thaliana	sp\|Q8W4Q3\|PIRL3_ARATH Plant intracellular Ras-group-related LRR protein 3	52.800%	Swiss-Prot	High
`Q7XK44`	Oryza sativa subsp. japonica	sp\|Q7XK44\|PIRL3_ORYSJ Plant intracellular Ras-group-related LRR protein 3	62.600%	Swiss-Prot	High
`Q6ZH85`	Oryza sativa subsp. japonica	sp\|Q6ZH85\|PIRL2_ORYSJ Plant intracellular Ras-group-related LRR protein 2	55.400%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card