LXL04_031881 | RubberDandelionOmics

Gene overview

LXL04_031881

Reference: OH-1004 Chr: Chr07 Coordinates: 12609247-12612243 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1539 bp · LXL04_031881|LXL04_031881|OH1004|cDNA

ATGGATCCAAACCCTAAGAACTTTCCAATTCTCTCGTATGTAATGGCCAAACTCCCCAGTGTCAGCCGGTCTCAGTCACCGGAGTTTGACATTGAACAACCACCGCCGACGGCTCCTTCCACATCCGAACCAGAACCTTACTTCGAACTCACTGAACGGATGCCTTACTTGAGCGATCCTGAACTACTTGCTTCCATGCGTGCAGCTGTCGACGATGTATCTCGGACACGATCTGTACTAAAAACCCTAGGCGAGTGTCC...

CDS

Download CDS FASTA

1539 bp · LXL04_031881|LXL04_031881|OH1004|CDS

ATGGATCCAAACCCTAAGAACTTTCCAATTCTCTCGTATGTAATGGCCAAACTCCCCAGTGTCAGCCGGTCTCAGTCACCGGAGTTTGACATTGAACAACCACCGCCGACGGCTCCTTCCACATCCGAACCAGAACCTTACTTCGAACTCACTGAACGGATGCCTTACTTGAGCGATCCTGAACTACTTGCTTCCATGCGTGCAGCTGTCGACGATGTATCTCGGACACGATCTGTACTAAAAACCCTAGGCGAGTGTCC...

Protein

Download Protein FASTA

512 aa · LXL04_031881|LXL04_031881|OH1004|PROTEIN

MDPNPKNFPILSYVMAKLPSVSRSQSPEFDIEQPPPTAPSTSEPEPYFELTERMPYLSDPELLASMRAAVDDVSRTRSVLKTLGECPDHEFVDIARSRLAEMDKSLSNQLEEVSLSDNDAEEDDKRKEEEREKQSFKAVISLYEMHQSYEKMLSEAEKRLEKLYDAAKKGGKSVAVDDQGCSSESTGVEDDVQDEVVAILNDALTNELARIDLSERRLPFLPEAFGKLRMLVSLKISSNQLQAIPDSIAGLENLEELNAS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_031881`
TK1151 ID	TkA08G134140
OH-1004 ID	LXL04_031881
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_031881

Location Chr07:12609247-12612243 (+)

Description Similar to PIRL1: Plant intracellular Ras-group-related LRR protein 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g05850`	Leucine-rich repeat protein that likely mediates protein interactions, possibly in the context of signal transduction.	PIRL1 and PIRL9, encoding members of a novel plant-specific family of leucine-rich repeat proteins, are essential for differentiation of microspores into pollen.2010 · DOI: 10.1007/s00425-010-1242-6 Effect of sporophytic PIRL9 genotype on post-meiotic expression of the Arabidopsis pirl1;pirl9 mutant pollen phenotype.2011 · DOI: 10.1007/s00425-010-1324-5
`At3g11330`	Leucine-rich repeat protein that likely mediates protein interactions, possibly in the context of signal transduction.	PIRL1 and PIRL9, encoding members of a novel plant-specific family of leucine-rich repeat proteins, are essential for differentiation of microspores into pollen.2010 · DOI: 10.1007/s00425-010-1242-6 Effect of sporophytic PIRL9 genotype on post-meiotic expression of the Arabidopsis pirl1;pirl9 mutant pollen phenotype.2011 · DOI: 10.1007/s00425-010-1324-5
`At1g12970`	Leucine-rich repeat protein that likely mediates protein interactions, possibly in the context of signal transduction.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os04g0476700`	Leucine-rich repeat protein that likely mediates protein interactions, possibly in the context of signal transduction.	No verified direct reference in this release
`Os02g0593600`	Leucine-rich repeat protein that likely mediates protein interactions, possibly in the context of signal transduction.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031881 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009416 response to light stimulus Biological Process

GO:0009555 pollen development Biological Process

GO:0035556 intracellular signal transduction Biological Process

GO:0046777 protein autophosphorylation Biological Process

GO:0055046 microgametogenesis Biological Process

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0004674 protein serine/threonine kinase activity Molecular Function

KEGG gene cross-reference

ath:AT1G12970

ath:AT3G11330

ath:AT5G05850

dosa:Os02g0593600

dosa:Os04g0476700

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.313

Rank 1 · LXL04_031881 · OH-1004

Cytoplasm0.286

Rank 2 · LXL04_031881 · OH-1004

Nucleus0.278

Rank 3 · LXL04_031881 · OH-1004

Endoplasmic reticulum0.097

Rank 4 · LXL04_031881 · OH-1004

Golgi apparatus0.087

Rank 5 · LXL04_031881 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13855.13LRR_8208-264 aa

PF12799.14LRR_4231-269 aa

PF12799.14LRR_4253-291 aa

PF13855.13LRR_8260-310 aa

PF23598.2LRR_14264-328 aa

PF13855.13LRR_8307-357 aa

PF23598.2LRR_14320-376 aa

PF12799.14LRR_4345-387 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_031881	`PF13855.13`	LRR_8	208	264	4.1e-23	81.6
LXL04_031881	`PF12799.14`	LRR_4	231	269	9.8e-20	70.9
LXL04_031881	`PF12799.14`	LRR_4	253	291	9.8e-20	70.9
LXL04_031881	`PF13855.13`	LRR_8	260	310	4.1e-23	81.6
LXL04_031881	`PF23598.2`	LRR_14	264	328	3.6e-25	89.2
LXL04_031881	`PF13855.13`	LRR_8	307	357	4.1e-23	81.6
LXL04_031881	`PF23598.2`	LRR_14	320	376	3.6e-25	89.2
LXL04_031881	`PF12799.14`	LRR_4	345	387	9.8e-20	70.9
LXL04_031881	`PF13855.13`	LRR_8	354	405	4.1e-23	81.6
LXL04_031881	`PF13855.13`	LRR_8	368	428	4.1e-23	81.6
LXL04_031881	`PF23598.2`	LRR_14	381	425	3.6e-25	89.2
LXL04_031881	`PF12799.14`	LRR_4	393	427	9.8e-20	70.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FFJ3`	Arabidopsis thaliana	Plant intracellular Ras-group-related LRR protein 1	54.264%	Swiss-Prot	strong database homology
`Q8VYG9`	Arabidopsis thaliana	Plant intracellular Ras-group-related LRR protein 9	52.703%	Swiss-Prot	strong database homology
`Q8W4Q3`	Arabidopsis thaliana	Plant intracellular Ras-group-related LRR protein 3	43.385%	Swiss-Prot	moderate database homology
`Q7XK44`	Oryza sativa subsp. japonica	Plant intracellular Ras-group-related LRR protein 3	51.724%	Swiss-Prot	strong database homology
`Q6ZH85`	Oryza sativa subsp. japonica	Plant intracellular Ras-group-related LRR protein 2	47.400%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card