TkA08G130690 | RubberDandelionOmics

Gene overview

TkA08G130690

Reference: TK1151 Chr: Chr08 Coordinates: 33903117-33906104 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1259 bp · TkA08G130690|TK1151|cDNA

CACTCGCCGCTTACTTTAATTGAGTTCTCATTATCATCAATTCAAATACCATAAATTCGATCTCTCTATTTATCACTCTCACTCGGTTGTTCGATCTGTTGGAGATCATCGATGGTGATGATGGATATGATAAATTCAGTGCTTAATTGGGTTGTACCGCCTGCAAGTCTGGTGATGCTGGCGTTCTCATGGCCGGCGCTTACATTCATCAACACCTGTGAATGGCTTTACTATTCTTTCGTTGATGAAGATATGAATGA...

CDS

Download CDS FASTA

1080 bp · TkA08G130690|TK1151|CDS

ATGGTGATGATGGATATGATAAATTCAGTGCTTAATTGGGTTGTACCGCCTGCAAGTCTGGTGATGCTGGCGTTCTCATGGCCGGCGCTTACATTCATCAACACCTGTGAATGGCTTTACTATTCTTTCGTTGATGAAGATATGAATGACAAAGTTGTCATCGTCACTGGCGCTTCTTCTGGTATCGGCGAGCAAATCGCGTATGAATATGCGAAGAAGAGAGCAAATCTGGTATTAGTCGCACGGAGAGATCAGCGACT...

Protein

Download Protein FASTA

359 aa · TkA08G130690|TK1151|PROTEIN

MVMMDMINSVLNWVVPPASLVMLAFSWPALTFINTCEWLYYSFVDEDMNDKVVIVTGASSGIGEQIAYEYAKKRANLVLVARRDQRLHGISENAKRLGAPNVLIMAADVVKEDDCRRFVNETINYYGRIDHLVNTASLGHTFYFEEANDASVFPILMDINFWGNVYPTYVALPYLRQSHGRIVVNAAVENWLPLPRMSIYSAAKAALVNFYETLRLELNGDVGITIATHGWIGAEMARGKFMLEEGAEMQWKEEREVQAA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G130690`
TK1151 ID	TkA08G130690
OH-1004 ID	LXL04_031801
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.200
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G130690

Location Chr08:33903117-33906104 (-)

Description Similar to SOP3: 11-beta-hydroxysteroid dehydrogenase B

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g10020`	11-beta-hydroxysteroid dehydrogenase-like 5.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031801 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006694 steroid biosynthetic process Biological Process

GO:0008202 steroid metabolic process Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005811 lipid droplet Cellular Component

GO:0005829 cytosol Cellular Component

GO:0012511 monolayer-surrounded lipid storage body Cellular Component

GO:0016020 membrane Cellular Component

GO:0004303 estradiol 17-beta-dehydrogenase [NAD(P)+] activity Molecular Function

GO:0016491 oxidoreductase activity Molecular Function

GO:0050661 NADP binding Molecular Function

GO:0070524 11-beta-hydroxysteroid dehydrogenase (NADP+) activity Molecular Function

GO:0072582 17-beta-hydroxysteroid dehydrogenase (NADP+) activity Molecular Function

KEGG gene cross-reference

ath:AT4G10020

sind:105175113

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.416

Rank 1 · TkA08G130690 · TK1151

Golgi apparatus0.182

Rank 2 · TkA08G130690 · TK1151

Cytoplasm0.143

Rank 3 · TkA08G130690 · TK1151

Mitochondrion0.127

Rank 4 · TkA08G130690 · TK1151

Nucleus0.120

Rank 5 · TkA08G130690 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00106adh_short51-238 aa

PF08659KR53-151 aa

PF01370Epimerase53-140 aa

PF13561adh_short_C257-263 aa

PF30636Methyltransf_3766-108 aa

PF01189Methyltr_RsmB-F69-114 aa

PF30636Methyltransf_37177-186 aa

PF01370Epimerase193-216 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G130690	`PF00106`	adh_short	51	238	2.4e-36	125.8
TkA08G130690	`PF08659`	KR	53	151	6.1e-06	27.0
TkA08G130690	`PF01370`	Epimerase	53	140	0.16	12.1
TkA08G130690	`PF13561`	adh_short_C2	57	263	2.4e-21	77.1
TkA08G130690	`PF30636`	Methyltransf_37	66	108	0.19	12.4
TkA08G130690	`PF01189`	Methyltr_RsmB-F	69	114	0.025	14.9
TkA08G130690	`PF30636`	Methyltransf_37	177	186	0.19	12.4
TkA08G130690	`PF01370`	Epimerase	193	216	0.16	12.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9T0G0`	Arabidopsis thaliana	sp\|Q9T0G0\|HSD5_ARATH 11-beta-hydroxysteroid dehydrogenase-like 5	70.300%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card