TkA08G130590 | RubberDandelionOmics

Gene overview

TkA08G130590

Reference: TK1151 Chr: Chr08 Coordinates: 33883081-33885251 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1957 bp · TkA08G130590|TK1151|cDNA

AAACACAAACACAGCGATCTAGCTAAACAAACCCAAATCCTTCGGTCCCCTAAAATGAGATTGTTTTGAGAACAATGGCAACAAAACTTCATCCATGTTAGCATCGCTTGTCACCTCCCTAAAGGAATCAGCAACTCAAAACAAGTTATCGAAAGCATTCAACCTTTTCTCTCTCGTCATACAACAAACCCACCATCACCATGCCTCTTCGTCTGATTTCTTGTTGCAGTCATTAGCTTCTCTTTTTGCATGCTGTTCGC...

CDS

Download CDS FASTA

1665 bp · TkA08G130590|TK1151|CDS

ATGCTGTTCGCAAGTCAAAGCAATTTCCCAAGAAAAATGGTGGAGAACGGAATTATCCCTGACAATTTCACTTACCCGTCTGTTCTCAAGGCTTGTGGAGAGGAATTAGATTTGGGTTTCGGGAGGGAAGTTCATGAATCGATTACGAATGCGGGTTTGGAATGGAATTTGTTCGTGCACAATGCGTTGGTGTTTATGTATGGAAAATGCGGAGACCTAAATATTGCACGCAAGTTGTTCGACCAAATGCCTGTGACAGA...

Protein

Download Protein FASTA

554 aa · TkA08G130590|TK1151|PROTEIN

MLFASQSNFPRKMVENGIIPDNFTYPSVLKACGEELDLGFGREVHESITNAGLEWNLFVHNALVFMYGKCGDLNIARKLFDQMPVTDEISWNSIISGYASHGIWSEAFDLFNQMQNQNVQVNIIIWNTITGGYLKTGNYKQVLKLLSQLKSSDKLDPVSIINGLSACSHIGNLNLGKQIHNLAIRTYNHDYDNVKNTLITMYSRCKDLKHAHIVFNLVGNKTVITWNSIISGFSHLDNSEESSILFREMLHSGVDPNYIT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G130590`
TK1151 ID	TkA08G130590
OH-1004 ID	LXL04_031795
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	98.900
Protein coverage (%)	TK1151 97.653 / OH-1004 80.148 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G130590

Location Chr08:33883081-33885251 (-)

Description Similar to PCMP-E67: Pentatricopeptide repeat-containing protein At1g71490

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g71490`	Pentatricopeptide repeat-containing protein At1g71490.	No verified direct reference in this release
`At1g22830`	Pentatricopeptide repeat-containing protein At1g22830.	No verified direct reference in this release
`At4g13650`	Pentatricopeptide repeat-containing protein At4g13650.	No verified direct reference in this release
`At1g08070`	Involved in multiple sites RNA editing events in chloroplasts.	No verified direct reference in this release
`At2g34400`	Pentatricopeptide repeat-containing protein At2g34400.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031795 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009451 RNA modification Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0003723 RNA binding Molecular Function

GO:0008270 zinc ion binding Molecular Function

KEGG gene cross-reference

ath:AT1G22830

ath:AT1G71490

ath:AT5G16860

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.624

Rank 1 · TkA08G130590 · TK1151

Plastid0.209

Rank 2 · TkA08G130590 · TK1151

Nucleus0.050

Rank 3 · TkA08G130590 · TK1151

Cytoplasm0.035

Rank 4 · TkA08G130590 · TK1151

Peroxisome0.007

Rank 5 · TkA08G130590 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13041PPR_212-32 aa

PF13812PPR_312-34 aa

PF17177PPR_long12-71 aa

PF12854PPR_116-27 aa

PF23276TPR_2427-83 aa

PF13812PPR_347-83 aa

PF12854PPR_152-83 aa

PF13041PPR_259-83 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G130590	`PF13041`	PPR_2	12	32	9.8e-55	183.2
TkA08G130590	`PF13812`	PPR_3	12	34	1e-23	83.9
TkA08G130590	`PF17177`	PPR_long	12	71	7.7e-09	35.9
TkA08G130590	`PF12854`	PPR_1	16	27	3.8e-33	113.6
TkA08G130590	`PF23276`	TPR_24	27	83	3.6e-09	37.3
TkA08G130590	`PF13812`	PPR_3	47	83	1e-23	83.9
TkA08G130590	`PF12854`	PPR_1	52	83	3.8e-33	113.6
TkA08G130590	`PF13041`	PPR_2	59	83	9.8e-55	183.2
TkA08G130590	`PF01535`	PPR	59	83	6.2e-52	171.0
TkA08G130590	`PF17049`	AEP1	59	98	0.049	13.4
TkA08G130590	`PF22330`	Rib_mS39_PPR	73	101	0.035	14.6
TkA08G130590	`PF13041`	PPR_2	87	123	9.8e-55	183.2
TkA08G130590	`PF12854`	PPR_1	87	115	3.8e-33	113.6
TkA08G130590	`PF23276`	TPR_24	88	162	3.6e-09	37.3
TkA08G130590	`PF01535`	PPR	89	118	6.2e-52	171.0
TkA08G130590	`PF29070`	MSC6_N	90	149	3.7e-10	40.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C9I6`	Arabidopsis thaliana	sp\|Q9C9I6\|PP116_ARATH Pentatricopeptide repeat-containing protein At1g71490	55.100%	Swiss-Prot	High
`Q4V389`	Arabidopsis thaliana	sp\|Q4V389\|PPR55_ARATH Pentatricopeptide repeat-containing protein At1g22830	51.500%	Swiss-Prot	High
`Q9SVP7`	Arabidopsis thaliana	sp\|Q9SVP7\|PP307_ARATH Pentatricopeptide repeat-containing protein At4g13650	33.500%	Swiss-Prot	Medium
`Q9LN01`	Arabidopsis thaliana	sp\|Q9LN01\|PPR21_ARATH Pentatricopeptide repeat-containing protein At1g08070, chloroplastic	35.600%	Swiss-Prot	Medium
`O64705`	Arabidopsis thaliana	sp\|O64705\|PP184_ARATH Pentatricopeptide repeat-containing protein At2g34400	34.200%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card