TkA08G126760 | RubberDandelionOmics

Gene overview

TkA08G126760

Reference: TK1151 Chr: Chr08 Coordinates: 32960473-32962655 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1664 bp · TkA08G126760|TK1151|cDNA

TAAAATCAGATTAAAAATGGCGGCATCTTCCTTCATTATATTACTTACAACAATCTCACCCCATTTCACCAACATCAATCTCCGCCTCATTCTTCTGGTTTCTTGGGTCGAAGGATTATTAATCAATGGCAGACCAGGAGAACAACTTAGGAGTGAGGGTTACTCGTCAGGCGAAGAAGAGGGCCATGGAGTCGGTTGGATCTCAGTTTCAACCGGCGAACAAAAAGAGAGTGGTGTTAGGTGAGCTATCAAGTAATGTG...

CDS

Download CDS FASTA

1119 bp · TkA08G126760|TK1151|CDS

ATGGCAGACCAGGAGAACAACTTAGGAGTGAGGGTTACTCGTCAGGCGAAGAAGAGGGCCATGGAGTCGGTTGGATCTCAGTTTCAACCGGCGAACAAAAAGAGAGTGGTGTTAGGTGAGCTATCAAGTAATGTGGTTACATCGGAGAATCCAAAGGATGGATCTGATATTGTTGAAAAGACAAAATGTGGGTTGAAGAAGGTGAAGAAAGCTGTGAAAGCAGTGATACCAGAGGCGAAAAAACATGAACTTGCTACCGA...

Protein

Download Protein FASTA

372 aa · TkA08G126760|TK1151|PROTEIN

MADQENNLGVRVTRQAKKRAMESVGSQFQPANKKRVVLGELSSNVVTSENPKDGSDIVEKTKCGLKKVKKAVKAVIPEAKKHELATEKMDDAVVDPQMCEAYVSDIYEYLHNMEMEAKRIPLSDYVEKVQKDVTVNMRGVLVDWLVEVAEEYKLLPDTLYLTISYIDRFLSVNLLNRQRLQLLGVSSMLIASKYEEISPPHTEDFCYITDNTYTKQEIVKMEADVLKTLKFEMGSPTVKTFLRRFTRIAQEEYNIPNLQL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G126760`
TK1151 ID	TkA08G126760
OH-1004 ID	LXL04_031734
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	98.100
Protein coverage (%)	TK1151 96.505 / OH-1004 79.601 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G126760

Location Chr08:32960473-32962655 (-)

Description Similar to CYCA3-1: Putative cyclin-A3-1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g43080`	Putative cyclin-A3-1.	No verified direct reference in this release
`At1g47230`	Cyclin-A3-4.	No verified direct reference in this release
`At1g47210`	Cyclin-A3-2.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0607600`	Cyclin-A3-1.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031734 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000082 G1/S transition of mitotic cell cycle Biological Process

GO:0051301 cell division Biological Process

GO:0000307 cyclin-dependent protein kinase holoenzyme complex Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0016538 cyclin-dependent protein serine/threonine kinase regulator activity Molecular Function

KEGG gene cross-reference

ath:AT1G47210

ath:AT1G47220

ath:AT1G47230

ath:AT5G43080

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.806

Rank 1 · TkA08G126760 · TK1151

Cytoplasm0.248

Rank 2 · TkA08G126760 · TK1151

Mitochondrion0.048

Rank 3 · TkA08G126760 · TK1151

Cell membrane0.025

Rank 4 · TkA08G126760 · TK1151

Endoplasmic reticulum0.014

Rank 5 · TkA08G126760 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00134Cyclin_N105-233 aa

PF10637Ofd1_CTDD184-255 aa

PF02984Cyclin_C186-218 aa

PF02984Cyclin_C236-357 aa

PF00134Cyclin_N279-298 aa

PF00134Cyclin_N308-335 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G126760	`PF00134`	Cyclin_N	105	233	1e-46	158.5
TkA08G126760	`PF10637`	Ofd1_CTDD	184	255	0.091	12.9
TkA08G126760	`PF02984`	Cyclin_C	186	218	1e-36	126.3
TkA08G126760	`PF02984`	Cyclin_C	236	357	1e-36	126.3
TkA08G126760	`PF00134`	Cyclin_N	279	298	1e-46	158.5
TkA08G126760	`PF00134`	Cyclin_N	308	335	1e-46	158.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FMH5`	Arabidopsis thaliana	sp\|Q9FMH5\|CCA31_ARATH Putative cyclin-A3-1	58.700%	Swiss-Prot	High
`Q3ECW2`	Arabidopsis thaliana	sp\|Q3ECW2\|CCA34_ARATH Cyclin-A3-4	56.300%	Swiss-Prot	High
`Q9C6A9`	Arabidopsis thaliana	sp\|Q9C6A9\|CCA32_ARATH Cyclin-A3-2	54.700%	Swiss-Prot	High
`Q75I54`	Oryza sativa subsp. japonica	sp\|Q75I54\|CCA31_ORYSJ Cyclin-A3-1	64.400%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card