TkA08G124330 | RubberDandelionOmics

Gene overview

TkA08G124330

Reference: TK1151 Chr: Chr08 Coordinates: 32292857-32295657 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1224 bp · TkA08G124330|TK1151|cDNA

ATGATTAATGTAAATTACATCCAAAAGGGTCTCCTTTTCCCCCGGCCGGAAAATCAAGACTTCTCCATAACCACATTCTTGGAGGACCTCAAAGACGCTCTCTCCACCACGCTTACTCATTTCCACCCACTCGCCGCCCGCTTAGCCACCATAAAACAAGAAAGCCCACCTTCCTGCATTGTATACTTGAACCCTGAGAATAGCCCCGGAGCCAGATTTATCCATTCGGCAGTTAATATTACGGTGGCGGAGATTCTTAC...

CDS

Download CDS FASTA

1224 bp · TkA08G124330|TK1151|CDS

ATGATTAATGTAAATTACATCCAAAAGGGTCTCCTTTTCCCCCGGCCGGAAAATCAAGACTTCTCCATAACCACATTCTTGGAGGACCTCAAAGACGCTCTCTCCACCACGCTTACTCATTTCCACCCACTCGCCGCCCGCTTAGCCACCATAAAACAAGAAAGCCCACCTTCCTGCATTGTATACTTGAACCCTGAGAATAGCCCCGGAGCCAGATTTATCCATTCGGCAGTTAATATTACGGTGGCGGAGATTCTTAC...

Protein

Download Protein FASTA

407 aa · TkA08G124330|TK1151|PROTEIN

MINVNYIQKGLLFPRPENQDFSITTFLEDLKDALSTTLTHFHPLAARLATIKQESPPSCIVYLNPENSPGARFIHSAVNITVAEILTPVDVPVIVQSFFDHHKAIDHDGHHMSLLSIQVTELADGIFIGCSINHMVVDGSSYWHFFNSFSEVFRSKAQNVVQRWIPEGSDPIFTLPFTHEDQFIDRPNPPLLRERIFHFSPASLSKLKAKVNIEWNTTKISSLQALSAVVWRCVTRARRFAADRETGCNLAINNRRRLSP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G124330`
TK1151 ID	TkA08G124330
OH-1004 ID	LXL04_031699
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	78.000
Protein coverage (%)	TK1151 100.000 / OH-1004 94.085 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G124330

Location Chr08:32292857-32295657 (-)

Description Similar to At3g50280: Uncharacterized acetyltransferase At3g50280

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g50280`	Uncharacterized acetyltransferase At3g50280.	No verified direct reference in this release
`At5g67160`	Required for pathogen-induced salicylic acid (SA) accumulation and SA-mediated resistance to virulent and avirulent pathogens (e.g. P.syringae).	An important role of a BAHD acyl transferase-like protein in plant innate immunity.2009 · DOI: 10.1111/j.1365-313x.2008.03747.x
`At5g23940`	Required for incorporation of 9(10),16-dihydroxy-hexadecanoic acid into cutin.	No verified direct reference in this release
`At5g39050`	Malonyltransferase acting on xenobiotic glucosides.	Malonylation is a key reaction in the metabolism of xenobiotic phenolic glucosides in Arabidopsis and tobacco.2010 · DOI: 10.1111/j.1365-313x.2010.04298.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031699 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006952 defense response Biological Process

GO:0009617 response to bacterium Biological Process

GO:0009697 salicylic acid biosynthetic process Biological Process

GO:0009753 response to jasmonic acid Biological Process

GO:0010090 trichome morphogenesis Biological Process

GO:0010143 cutin biosynthetic process Biological Process

GO:0090626 plant epidermis morphogenesis Biological Process

GO:1900150 regulation of defense response to fungus Biological Process

GO:1900424 regulation of defense response to bacterium Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0016747 acyltransferase activity, transferring groups other than amino-acyl groups Molecular Function

KEGG gene cross-reference

ath:AT3G50280

ath:AT5G23940

ath:AT5G67160

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.705

Rank 1 · TkA08G124330 · TK1151

Nucleus0.310

Rank 2 · TkA08G124330 · TK1151

Endoplasmic reticulum0.084

Rank 3 · TkA08G124330 · TK1151

Cell membrane0.073

Rank 4 · TkA08G124330 · TK1151

Plastid0.051

Rank 5 · TkA08G124330 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02458Transferase2-400 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G124330	`PF02458`	Transferase	2	400	5.9e-67	226.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SND9`	Arabidopsis thaliana	sp\|Q9SND9\|Y3028_ARATH Uncharacterized acetyltransferase At3g50280	34.500%	Swiss-Prot	Medium
`Q9FH97`	Arabidopsis thaliana	sp\|Q9FH97\|EPS1_ARATH Protein ENHANCED PSEUDOMONAS SUSCEPTIBILITY 1	34.500%	Swiss-Prot	Medium
`Q9FF86`	Arabidopsis thaliana	sp\|Q9FF86\|DCR_ARATH BAHD acyltransferase DCR	33.700%	Swiss-Prot	Medium
`Q940Z5`	Arabidopsis thaliana	sp\|Q940Z5\|PMAT1_ARATH Phenolic glucoside malonyltransferase 1	21.400%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card