TkA08G114520 | RubberDandelionOmics

Gene overview

TkA08G114520

Reference: TK1151 Chr: Chr08 Coordinates: 29789330-29791642 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1269 bp · TkA08G114520|TK1151|cDNA

GAAAGCCCACCCATTTCGGGGTACTTCCGTCAATTCGCTATTCTCCCATAACACGCATATATTCTGGTACTACTTCACTAATCGTGTCCACCACCACCAACAACCAAACAACCCTCCTCTTCCCTAGAGAAACAAAATTTGCAGGAAGAACACATGGCAACGGAGATCAGCAAGATTCTGGTGATTGGAGGAACTGGGTACATCGGAAAGTTTGTGGTGGACGCTAGTGCAAAGGCCGGTCACCCAACCTACGTTCTGGT...

CDS

Download CDS FASTA

930 bp · TkA08G114520|TK1151|CDS

ATGGCAACGGAGATCAGCAAGATTCTGGTGATTGGAGGAACTGGGTACATCGGAAAGTTTGTGGTGGACGCTAGTGCAAAGGCCGGTCACCCAACCTACGTTCTGGTTCGAGAATCCACGGTGTCGGATCCTGTGAAGGGTAAGCTTGTCCAGAGCTTCAAGAACTCCGGCGTCAATCTGGTTTACGGTGATCTGAACGATCATGAAAGCTTGGTGAAGGCGATTAAGAAGGTTGATGTGGTGATCTCAACAGTCGGTAA...

Protein

Download Protein FASTA

309 aa · TkA08G114520|TK1151|PROTEIN

MATEISKILVIGGTGYIGKFVVDASAKAGHPTYVLVRESTVSDPVKGKLVQSFKNSGVNLVYGDLNDHESLVKAIKKVDVVISTVGNMQIPDQTKIIAAIKEAGNVKRFFPSEFGVDVDRQNAVEPASSTFSGKVQIRRAIEAEGIPFTYVASGCFAGYFLPTMVQPGATAPPRDKVTILGDGSPKVVYNEEHDIGTYTIKAVDDPRTLNKILYIKPPNNTLSFNDLVSLWEKKIDKSLEKDFVPEEQVLKLIQESGFPI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G114520`
TK1151 ID	TkA08G114520
OH-1004 ID	LXL04_031564
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 98.408 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G114520

Location Chr08:29789330-29791642 (-)

Description Similar to TP7: Phenylcoumaran benzylic ether reductase TP7

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g75280`	Isoflavone reductase homolog P3.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031564 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006979 response to oxidative stress Biological Process

GO:0009699 phenylpropanoid biosynthetic process Biological Process

GO:0009807 lignan biosynthetic process Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0000166 nucleotide binding Molecular Function

GO:0016491 oxidoreductase activity Molecular Function

GO:0050664 oxidoreductase activity, acting on NAD(P)H, oxygen as acceptor Molecular Function

KEGG gene cross-reference

ath:AT1G75280

nta:107822129

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.814

Rank 1 · TkA08G114520 · TK1151

Nucleus0.212

Rank 2 · TkA08G114520 · TK1151

Endoplasmic reticulum0.070

Rank 3 · TkA08G114520 · TK1151

Cell membrane0.050

Rank 4 · TkA08G114520 · TK1151

Peroxisome0.047

Rank 5 · TkA08G114520 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05368NmrA6-305 aa

PF01118Semialdhyde_dh7-89 aa

PF01370Epimerase8-92 aa

PF03435Sacchrp_dh_NADP8-94 aa

PF08659KR8-79 aa

PF02719Polysacc_synt_28-91 aa

PF00106adh_short8-80 aa

PF16363GDP_Man_Dehyd9-80 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G114520	`PF05368`	NmrA	6	305	2.9e-98	329.9
TkA08G114520	`PF01118`	Semialdhyde_dh	7	89	0.11	13.6
TkA08G114520	`PF01370`	Epimerase	8	92	3e-10	40.6
TkA08G114520	`PF03435`	Sacchrp_dh_NADP	8	94	6.2e-06	27.3
TkA08G114520	`PF08659`	KR	8	79	0.001	19.7
TkA08G114520	`PF02719`	Polysacc_synt_2	8	91	0.0086	16.0
TkA08G114520	`PF00106`	adh_short	8	80	0.023	14.9
TkA08G114520	`PF16363`	GDP_Man_Dehyd	9	80	4e-07	30.5
TkA08G114520	`PF01073`	3Beta_HSD	9	90	2.1e-06	27.7
TkA08G114520	`PF02254`	TrkA_N	10	102	0.00097	20.2
TkA08G114520	`PF13460`	NAD_binding_10	12	154	4.6e-14	53.4
TkA08G114520	`PF13685`	Fe-ADH_2	29	100	0.082	13.6
TkA08G114520	`PF20026`	DUF6434	89	117	0.17	12.6
TkA08G114520	`PF01370`	Epimerase	90	161	3e-10	40.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P52577`	Arabidopsis thaliana	sp\|P52577\|IFRH_ARATH Isoflavone reductase homolog P3	76.500%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card