Gene Card
Gene overview
cDNA / CDS / Protein Sequences
2201 bp · TkA08G111930|TK1151|cDNA
CACAAGAAAGAACCTGCGGAAGCGGAACCCTTAAACCCTAATTTAAAACACAAGGGGGAAAATCTTGCTGACAATGACTCTAAAAGACGAGAAAAAAAAGTTAAAGAAAATGAAACGACATTGGAAACAGTAACAAATCTGTGGAATTGGGATTGAAAGTCGAAACCCCAATTTGCCCAATCCCTTCTCACGCTCTCTCTCACTCTCTTTTTTCTATATTAGTTATAAGATTTTATTACCCTTATTAATACCAATCACAC...
1563 bp · TkA08G111930|TK1151|CDS
ATGTCAACGCCGGTGGCAGAGACGGAGAAGAAAGAAGAGGAGGTGAAGGGAGGTGAGCTGTTGTTCTGTGGTACGACAGCTTGGGACACCATTGGCCGAAAGAAGGGTTGCGAAGGCAACTTAGTTTCTCCGACACGGCTTCGTCCTCTCGTCGGCGTTGACATTCGCTATGTAGCATCCGGTTGTGCATCTTGTCATTGTGTGGCACTGGATGTGGATGGACGTTGCTATACTTGGGGAAGAAACGATAAGGGACAGCT...
Protein
Download Protein FASTA520 aa · TkA08G111930|TK1151|PROTEIN
MSTPVAETEKKEEEVKGGELLFCGTTAWDTIGRKKGCEGNLVSPTRLRPLVGVDIRYVASGCASCHCVALDVDGRCYTWGRNDKGQLGHGDQIQRDRPTVVSALASYKIVKAASGKSHTVVVTEDGLSLAFGWNKHGQLGTGSAKNEIELYPVRCLVSEVNTVACGADFTVWLTSVEGATILTAGLPQYGQLGHGTDNEYNTKDSSVRLAYEAQPRPKAISAFANETIVKVGCGSNHTVAVDSNGHVYTWGYGGYGRLGH...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA08G111930 |
|---|---|
| TK1151 ID | TkA08G111930 |
| OH-1004 ID | LXL04_031530 |
| Relationship / confidence | Rbh High Identity Coverage Synteny / Strict |
| Protein identity (%) | 97.300 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA08G111930 |
|---|---|
| Location | Chr08:29114387-29118004 (-) |
| Description | Similar to rcc2: Protein RCC2 homolog |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0007229 integrin-mediated signaling pathway Biological Process GO:0009411 response to UV Biological Process GO:0009649 entrainment of circadian clock Biological Process GO:0010224 response to UV-B Biological Process GO:0010762 regulation of fibroblast migration Biological Process GO:0010971 positive regulation of G2/M transition of mitotic cell cycle Biological Process GO:0030334 regulation of cell migration Biological Process GO:0034260 negative regulation of GTPase activity Biological Process GO:0045184 establishment of protein localization Biological Process GO:0048041 focal adhesion assembly Biological Process GO:0051301 cell division Biological Process GO:0051895 negative regulation of focal adhesion assembly Biological Process |
| KEGG gene cross-reference | ath:AT5G63860 dre:406455 hsa:55920 mmu:108911 xla:734455 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF25390WD40_RLD17-171 aaPF00415RCC142-65 aaPF25384Alsin_RLD46-88 aaPF27679RIN13_N60-83 aaPF13540RCC1_264-86 aaPF05593RHS_repeat71-87 aaPF00415RCC173-122 aaPF25384Alsin_RLD75-149 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA08G111930 | PF25390 | WD40_RLD | 17 | 171 | 1.1e-66 | 226.3 |
| TkA08G111930 | PF00415 | RCC1 | 42 | 65 | 8.9e-59 | 196.6 |
| TkA08G111930 | PF25384 | Alsin_RLD | 46 | 88 | 8.2e-15 | 55.5 |
| TkA08G111930 | PF27679 | RIN13_N | 60 | 83 | 0.028 | 15.3 |
| TkA08G111930 | PF13540 | RCC1_2 | 64 | 86 | 1.1e-24 | 86.3 |
| TkA08G111930 | PF05593 | RHS_repeat | 71 | 87 | 0.051 | 14.7 |
| TkA08G111930 | PF00415 | RCC1 | 73 | 122 | 8.9e-59 | 196.6 |
| TkA08G111930 | PF25384 | Alsin_RLD | 75 | 149 | 8.2e-15 | 55.5 |
| TkA08G111930 | PF24684 | Vgb_lyase | 103 | 177 | 0.025 | 14.1 |
| TkA08G111930 | PF13540 | RCC1_2 | 109 | 138 | 1.1e-24 | 86.3 |
| TkA08G111930 | PF05593 | RHS_repeat | 121 | 141 | 0.051 | 14.7 |
| TkA08G111930 | PF00415 | RCC1 | 126 | 171 | 8.9e-59 | 196.6 |
| TkA08G111930 | PF25390 | WD40_RLD | 152 | 395 | 1.1e-66 | 226.3 |
| TkA08G111930 | PF13540 | RCC1_2 | 162 | 191 | 1.1e-24 | 86.3 |
| TkA08G111930 | PF00415 | RCC1 | 182 | 241 | 8.9e-59 | 196.6 |
| TkA08G111930 | PF13540 | RCC1_2 | 228 | 256 | 1.1e-24 | 86.3 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.