LXL04_031530 | RubberDandelionOmics

Gene overview

LXL04_031530

Reference: OH-1004 Chr: Chr07 Coordinates: 7173707-7176689 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1563 bp · LXL04_031530|LXL04_031530|OH1004|cDNA

ATGTCAACGCCGGTGGCAGAGACggagaagaaagaagaggaggTGAAGGGAGGTGAGCTGTTGTTCTGTGGTACGACAGCTTGGGACACCATTGGCCGAAAGAAGGGTTGCGAAGGCAACTTAGTTTCTCCGACACGGCTTCGTCCTCTCGTCGGCGTTGACATTCGCTATGTAGCATCCGGTTGTGCATCTTGTCATTGTGTGGCACTGGATGTGGATGGACGTTGCTATACTTGGGGAAGAAACGATAAGGGACAGCT...

CDS

Download CDS FASTA

1563 bp · LXL04_031530|LXL04_031530|OH1004|CDS

ATGTCAACGCCGGTGGCAGAGACGGAGAAGAAAGAAGAGGAGGTGAAGGGAGGTGAGCTGTTGTTCTGTGGTACGACAGCTTGGGACACCATTGGCCGAAAGAAGGGTTGCGAAGGCAACTTAGTTTCTCCGACACGGCTTCGTCCTCTCGTCGGCGTTGACATTCGCTATGTAGCATCCGGTTGTGCATCTTGTCATTGTGTGGCACTGGATGTGGATGGACGTTGCTATACTTGGGGAAGAAACGATAAGGGACAGCT...

Protein

Download Protein FASTA

520 aa · LXL04_031530|LXL04_031530|OH1004|PROTEIN

MSTPVAETEKKEEEVKGGELLFCGTTAWDTIGRKKGCEGNLVSPTRLRPLVGVDIRYVASGCASCHCVALDVDGRCYTWGRNDKGQLGHGDQIQRDRPTVVSALASYKIVKAASGKSHTVVVTEDGLSLAFGWNKHGQLGTGSAKNEIELYPVRCLVSEVNTVACGADFTVWLTSVEGATILTAGLPQYGQLGHGTDNEYNTKDSSVRLAYEAQPRPKAISAFANETIVKVGCGSNHTVAVDSNGHVYTWGYGGYGRLGH...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_031530`
TK1151 ID	TkA08G111930
OH-1004 ID	LXL04_031530
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.300
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_031530

Location Chr07:7173707-7176689 (-)

Description Similar to rcc2: Protein RCC2 homolog

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g63860`	UV-B specific signaling component that acts as a UV-B photoreceptor and plays a key role in establishing UV-protective responses in plants.	A UV-B-specific signaling component orchestrates plant UV protection.2005 · DOI: 10.1073/pnas.0507187102 UV-B promotes rapid nuclear translocation of the Arabidopsis UV-B specific signaling component UVR8 and activates its function in the nucleus.2007 · DOI: 10.1105/tpc.107.053330 UV-B signaling pathways with different fluence-rate response profiles are distinguished in mature Arabidopsis leaf tissue by requirement for UVR8, HY5, and HYH.2008 · DOI: 10.1104/pp.107.108456 Interaction of COP1 and UVR8 regulates UV-B-induced photomorphogenesis and stress acclimation in Arabidopsis.2009 · DOI: 10.1038/emboj.2009.4 UVR8 in Arabidopsis thaliana regulates multiple aspects of cellular differentiation during leaf development in response to ultraviolet B radiation.2009 · DOI: 10.1111/j.1469-8137.2009.02855.x Negative feedback regulation of UV-B-induced photomorphogenesis and stress acclimation in Arabidopsis.2010 · DOI: 10.1073/pnas.0914532107 Functional interaction of the circadian clock and UV RESISTANCE LOCUS 8-controlled UV-B signaling pathways in Arabidopsis thaliana.2011 · DOI: 10.1111/j.1365-313x.2011.04573.x Perception of UV-B by the Arabidopsis UVR8 protein.2011 · DOI: 10.1126/science.1200660 UVR8 mediates UV-B-induced Arabidopsis defense responses against Botrytis cinerea by controlling sinapate accumulation.2012 · DOI: 10.1093/mp/sss025 C-terminal region of the UV-B photoreceptor UVR8 initiates signaling through interaction with the COP1 protein.2012 · DOI: 10.1073/pnas.1210898109 In vivo function of tryptophans in the Arabidopsis UV-B photoreceptor UVR8.2012 · DOI: 10.1105/tpc.112.101451 The UV-B photoreceptor UVR8 promotes photosynthetic efficiency in Arabidopsis thaliana exposed to elevated levels of UV-B.2012 · DOI: 10.1007/s11120-012-9785-y

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031530 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0007229 integrin-mediated signaling pathway Biological Process

GO:0009411 response to UV Biological Process

GO:0009649 entrainment of circadian clock Biological Process

GO:0010224 response to UV-B Biological Process

GO:0010762 regulation of fibroblast migration Biological Process

GO:0010971 positive regulation of G2/M transition of mitotic cell cycle Biological Process

GO:0030334 regulation of cell migration Biological Process

GO:0034260 negative regulation of GTPase activity Biological Process

GO:0045184 establishment of protein localization Biological Process

GO:0048041 focal adhesion assembly Biological Process

GO:0051301 cell division Biological Process

GO:0051895 negative regulation of focal adhesion assembly Biological Process

KEGG gene cross-reference

ath:AT5G63860

dre:406455

hsa:55920

mmu:108911

xla:734455

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.855

Rank 1 · LXL04_031530 · OH-1004

Cytoplasm0.189

Rank 2 · LXL04_031530 · OH-1004

Cell membrane0.039

Rank 3 · LXL04_031530 · OH-1004

Mitochondrion0.029

Rank 4 · LXL04_031530 · OH-1004

Endoplasmic reticulum0.022

Rank 5 · LXL04_031530 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25390.2WD40_RLD17-171 aa

PF13540.13RCC1_264-86 aa

PF00415.25RCC173-122 aa

PF25384.2Alsin_RLD75-149 aa

PF13540.13RCC1_2109-138 aa

PF00415.25RCC1126-171 aa

PF25390.2WD40_RLD152-395 aa

PF00415.25RCC1182-241 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_031530	`PF25390.2`	WD40_RLD	17	171	1.1e-66	226.3
LXL04_031530	`PF13540.13`	RCC1_2	64	86	1.1e-24	86.3
LXL04_031530	`PF00415.25`	RCC1	73	122	8.8e-59	196.6
LXL04_031530	`PF25384.2`	Alsin_RLD	75	149	8.2e-15	55.5
LXL04_031530	`PF13540.13`	RCC1_2	109	138	1.1e-24	86.3
LXL04_031530	`PF00415.25`	RCC1	126	171	8.8e-59	196.6
LXL04_031530	`PF25390.2`	WD40_RLD	152	395	1.1e-66	226.3
LXL04_031530	`PF00415.25`	RCC1	182	241	8.8e-59	196.6
LXL04_031530	`PF13540.13`	RCC1_2	228	256	1.1e-24	86.3
LXL04_031530	`PF00415.25`	RCC1	244	280	8.8e-59	196.6
LXL04_031530	`PF00415.25`	RCC1	348	396	8.8e-59	196.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FN03`	Arabidopsis thaliana	Ultraviolet-B receptor UVR8	31.034%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card