Gene Card
Gene overview
cDNA / CDS / Protein Sequences
3340 bp · TkA08G110850|TK1151|cDNA
GTCTTTAACATAATGGTTTATCGGTGTTGTTCCCTTTTTGAATGTACATAACTTGTGTTCACAAATGAAGGCCAGCATAGCTGGTCGGATGTATCTGGATATTGTCTCACCAGTTGAGAGGTCAGGGTTTCGATCCTGGCTTCGGTGGGGATTTTCCTGGTGGGGCTTATTGAGCGGGTTGAAGCCTATTATGGAGACTTGCATTGCTCAAAGTAGGTAGAGACACTCACCGACCGTTTCCAAAAAAAAAAAAAAAAAAA...
2334 bp · TkA08G110850|TK1151|CDS
ATGCCGGTGTCAACTAGGTCTCATGTGAAGGTGATTCAAGATCGGAGTGAGGAAGAGAACAACCATATGCAGAATCATCATCAATTGAGGAATCCTCATCACGGTTTGAAAGAAAAGATGAAAGCTTTGACCCAATTGTACGAACAGCAGAAACAATCGTCAATTGCTCTCAGAAACACTTCTCCTAAACCAGACGCAAATCGATTTTCAACGCATCCAAGCGTGGATCTTTTGGCTGGTACTGGATCTTGCAAAAAAGA...
Protein
Download Protein FASTA777 aa · TkA08G110850|TK1151|PROTEIN
MPVSTRSHVKVIQDRSEEENNHMQNHHQLRNPHHGLKEKMKALTQLYEQQKQSSIALRNTSPKPDANRFSTHPSVDLLAGTGSCKKESDNQKKSRTIETHVMRENSMPISSTFTKNYVLPRQPPPMDDDAKENIAVAVGGGAGAGNGEKIVGFTFPPKRGVMSTTVARKLSMGTSHVAPDPKGKIPGGCATTGGGGGEEAVATESEGVTVKLGNVGSRILVFVRVRPLSKKEKEAGSRSCVRIVNQKEIYLTEFANENDY...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA08G110850 |
|---|---|
| TK1151 ID | TkA08G110850 |
| OH-1004 ID | LXL04_031514 |
| Relationship / confidence | Rbh High Identity Coverage Synteny / Strict |
| Protein identity (%) | 100.000 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA08G110850 | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr08:28837129-28841929 (-) | ||||||||||||
| Description | Similar to KIN8A: Kinesin-like protein KIN-8A | ||||||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
Rice
| ||||||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | ||||||||||||
| GO annotations (OH1004 source) | GO:0000070 mitotic sister chromatid segregation Biological Process GO:0007018 microtubule-based movement Biological Process GO:0007019 microtubule depolymerization Biological Process GO:0060404 axonemal microtubule depolymerization Biological Process GO:0070462 plus-end specific microtubule depolymerization Biological Process GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005871 kinesin complex Cellular Component GO:0005874 microtubule Cellular Component GO:0005929 cilium Cellular Component GO:0005930 axoneme Cellular Component GO:0061673 mitotic spindle astral microtubule Cellular Component | ||||||||||||
| KEGG gene cross-reference | ath:AT1G18550 dosa:Os01g0605500 hsa:124602 mmu:286942 osa:4324211 xla:373792 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF01166TSC2236-59 aaPF16796Microtub_bd219-368 aaPF00225Kinesin224-548 aaPF13191AAA_16294-320 aaPF13401AAA_22302-321 aaPF01166TSC22330-343 aaPF03670UPF0184458-509 aaPF31075PNT1561-595 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA08G110850 | PF01166 | TSC22 | 36 | 59 | 3.4 | 8.6 |
| TkA08G110850 | PF16796 | Microtub_bd | 219 | 368 | 8.4e-22 | 78.5 |
| TkA08G110850 | PF00225 | Kinesin | 224 | 548 | 2e-107 | 359.7 |
| TkA08G110850 | PF13191 | AAA_16 | 294 | 320 | 0.044 | 15.0 |
| TkA08G110850 | PF13401 | AAA_22 | 302 | 321 | 0.17 | 12.9 |
| TkA08G110850 | PF01166 | TSC22 | 330 | 343 | 3.4 | 8.6 |
| TkA08G110850 | PF03670 | UPF0184 | 458 | 509 | 0.63 | 11.2 |
| TkA08G110850 | PF31075 | PNT1 | 561 | 595 | 0.042 | 14.1 |
| TkA08G110850 | PF03670 | UPF0184 | 573 | 591 | 0.63 | 11.2 |
| TkA08G110850 | PF01166 | TSC22 | 574 | 591 | 3.4 | 8.6 |
| TkA08G110850 | PF13191 | AAA_16 | 576 | 589 | 0.044 | 15.0 |
| TkA08G110850 | PF13401 | AAA_22 | 623 | 706 | 0.17 | 12.9 |
| TkA08G110850 | PF31075 | PNT1 | 632 | 693 | 0.042 | 14.1 |
| TkA08G110850 | PF16796 | Microtub_bd | 644 | 685 | 8.4e-22 | 78.5 |
| TkA08G110850 | PF01166 | TSC22 | 648 | 672 | 3.4 | 8.6 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.