RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

LXL04_031514
Reference: OH-1004 Chr: Chr07 Coordinates: 7006362-7009387 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

2334 bp · LXL04_031514|LXL04_031514|OH1004|cDNA

ATGCCGGTGTCAACTAGGTCTCATGTGAAGGTGATTCAAGATCGGAGTGAGGAAGAGAACAACCATATGCAGAATCATCATCAATTGAGGAATCCTCATCACGGTTTGAAAGAAAAGATGAAAGCTTTGACCCAATTGTACGAACAGCAGAAACAATCGTCAATTGCTCTCAGAAACACTTCTCCTAAACCAGACGCAAATCGATTTTCAACGCATCCAAGCGTGGATCTTTTGGCTGGTACTGGATCTTGCAAAAAAGA...

CDS

Download CDS FASTA

2334 bp · LXL04_031514|LXL04_031514|OH1004|CDS

ATGCCGGTGTCAACTAGGTCTCATGTGAAGGTGATTCAAGATCGGAGTGAGGAAGAGAACAACCATATGCAGAATCATCATCAATTGAGGAATCCTCATCACGGTTTGAAAGAAAAGATGAAAGCTTTGACCCAATTGTACGAACAGCAGAAACAATCGTCAATTGCTCTCAGAAACACTTCTCCTAAACCAGACGCAAATCGATTTTCAACGCATCCAAGCGTGGATCTTTTGGCTGGTACTGGATCTTGCAAAAAAGA...

Protein

Download Protein FASTA

777 aa · LXL04_031514|LXL04_031514|OH1004|PROTEIN

MPVSTRSHVKVIQDRSEEENNHMQNHHQLRNPHHGLKEKMKALTQLYEQQKQSSIALRNTSPKPDANRFSTHPSVDLLAGTGSCKKESDNQKKSRTIETHVMRENSMPISSTFTKNYVLPRQPPPMDDDAKENIAVAVGGGAGAGNGEKIVGFTFPPKRGVMSTTVARKLSMGTSHVAPDPKGKIPGGCATTGGGGGEEAVATESEGVTVKLGNVGSRILVFVRVRPLSKKEKEAGSRSCVRIVNQKEIYLTEFANENDY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDLXL04_031514
Source versionOH-1004 / GCA_047496595.1_OSU_TarKok_2.0
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDLXL04_031514
LocationChr07:7006362-7009387 (-)
DescriptionSimilar to KIN8A: Kinesin-like protein KIN-8A
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At1g18550 Kinesin-like protein KIN-8A. No verified direct reference in this release

Rice

Reference gene IDPossible functionPapers / DOI
Os01g0605500 Kinesin-like protein KIN-8A. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_031514 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)
GO:0000070 mitotic sister chromatid segregation Biological Process
GO:0007018 microtubule-based movement Biological Process
GO:0007019 microtubule depolymerization Biological Process
GO:0060404 axonemal microtubule depolymerization Biological Process
GO:0070462 plus-end specific microtubule depolymerization Biological Process
GO:0005634 nucleus Cellular Component
GO:0005737 cytoplasm Cellular Component
GO:0005871 kinesin complex Cellular Component
GO:0005874 microtubule Cellular Component
GO:0005929 cilium Cellular Component
GO:0005930 axoneme Cellular Component
GO:0061673 mitotic spindle astral microtubule Cellular Component
KEGG gene cross-reference
ath:AT1G18550
dosa:Os01g0605500
hsa:124602
mmu:286942
osa:4324211
xla:373792
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.563
Rank 1 · LXL04_031514 · OH-1004
Nucleus0.425
Rank 2 · LXL04_031514 · OH-1004
Cell membrane0.112
Rank 3 · LXL04_031514 · OH-1004
Endoplasmic reticulum0.035
Rank 4 · LXL04_031514 · OH-1004
Mitochondrion0.022
Rank 5 · LXL04_031514 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16796.12Microtub_bd219-368 aa
PF00225.30Kinesin224-548 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
LXL04_031514PF16796.12Microtub_bd2193688.4e-2278.5
LXL04_031514PF00225.30Kinesin2245482e-107359.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
F4ICA0Arabidopsis thalianaKinesin-like protein KIN-8A59.849%Swiss-Protstrong database homology
Q0JLE4Oryza sativa subsp. japonicaKinesin-like protein KIN-8A58.376%Swiss-Protstrong database homology

JBrowse

View in Genome Browser