TkA08G110700 | RubberDandelionOmics

Gene overview

TkA08G110700

Reference: TK1151 Chr: Chr08 Coordinates: 28803837-28805852 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1191 bp · TkA08G110700|TK1151|cDNA

AGGATCCACTCGATTCGCTCCTTTTGTCGCTCCCACCGTTTCATCAAACACCCACCTGATTCCCCTTCGTATTCCTAATACCTAAAACTATAAAACGCAGCCTCATGAATCTCATCGCCTACCAACCCCACTCTCACCCATATCTCGCGTGCCACCCACGCGACCATAATTGCCCTACCTCTACCTGGTCAACACACCACGCTCCCCAACGCGCGTGGTTGATCTTAGTCGCCTGCGAACTTCCCCCTCTATATCGATAA...

CDS

Download CDS FASTA

486 bp · TkA08G110700|TK1151|CDS

ATGGAACCGATAGATATCGTTGGCAAGACGAAAGAGGATGCTTCGCTCCCAAAAGCCACGATGACCAAAATCATCAAAGAAATGTTACCTCCAGATGTACGTGTAGCAAGAGACACTCAAGATCTGTTAATCGAATGCTGTGTTGAATTCATAAACCTAATCTCATCAGAATCAAACGAAGTCTGTGGCAGAGAAGACAGAAGAACAATCGCACCAGAACATGTACTCAAAGCATTAGAGGTACTTGGCTTTGGAGAATA...

Protein

Download Protein FASTA

161 aa · TkA08G110700|TK1151|PROTEIN

MEPIDIVGKTKEDASLPKATMTKIIKEMLPPDVRVARDTQDLLIECCVEFINLISSESNEVCGREDRRTIAPEHVLKALEVLGFGEYIEEVYAAYEQHKHETMDTVRGVKCTNGAEMTEEEALAEQQRMFAEARARMNGGVPPVAKQQPEVEEEANLEADS

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G110700`
TK1151 ID	TkA08G110700
OH-1004 ID	LXL04_031511
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	83.900
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G110700

Location Chr08:28803837-28805852 (+)

Description Similar to DR1: Protein Dr1 homolog

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g23090`	Protein Dr1 homolog.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031511 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000122 negative regulation of transcription by RNA polymerase II Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0016480 negative regulation of transcription by RNA polymerase III Biological Process

GO:0017055 negative regulation of RNA polymerase II transcription preinitiation complex assembly Biological Process

GO:0034605 cellular response to heat Biological Process

GO:0045944 positive regulation of transcription by RNA polymerase II Biological Process

GO:0045995 regulation of embryonic development Biological Process

GO:0051123 RNA polymerase II preinitiation complex assembly Biological Process

GO:0051302 regulation of cell division Biological Process

GO:0051726 regulation of cell cycle Biological Process

KEGG gene cross-reference

afm:AFUA_3G02340

ath:AT5G23090

ddi:DDB_G0269638

rno:289881

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.913

Rank 1 · TkA08G110700 · TK1151

Cytoplasm0.275

Rank 2 · TkA08G110700 · TK1151

Mitochondrion0.023

Rank 3 · TkA08G110700 · TK1151

Cell membrane0.023

Rank 4 · TkA08G110700 · TK1151

Endoplasmic reticulum0.014

Rank 5 · TkA08G110700 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00125Histone12-79 aa

PF00808CBFD_NFYB_HMF14-79 aa

PF15510CENP-W16-82 aa

PF28009SCO591860-87 aa

PF00808CBFD_NFYB_HMF88-102 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G110700	`PF00125`	Histone	12	79	0.0039	18.3
TkA08G110700	`PF00808`	CBFD_NFYB_HMF	14	79	3.3e-21	76.0
TkA08G110700	`PF15510`	CENP-W	16	82	0.041	14.8
TkA08G110700	`PF28009`	SCO5918	60	87	0.18	12.5
TkA08G110700	`PF00808`	CBFD_NFYB_HMF	88	102	3.3e-21	76.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P49592`	Arabidopsis thaliana	sp\|P49592\|NC2B_ARATH Protein Dr1 homolog	81.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card