TkA08G107940 | RubberDandelionOmics

Gene overview

TkA08G107940

Reference: TK1151 Chr: Chr08 Coordinates: 28074900-28079353 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1576 bp · TkA08G107940|TK1151|cDNA

AAAGGAGTCGCTACTCCAGTTTCATCCCCGTTCTCTCTCTGTGGTTTAAACCATCCGGCGACCAGATCCACTTCCGGTGTCGCTACCACTGCTCCGACGACCGACGACCGCCGACCACTTCTCGATGTCGCTGCGTTCCTCCGACGACCGACGACCACTTCTCTCTCTATGTCGCTGCTTTACTCCGGCGACCACTTCCGGTACCCTTTTGACAGGTGTGTTGGTTTGAAGCGGTGACATGAGCTGTTTGGTGAGCTACA...

CDS

Download CDS FASTA

834 bp · TkA08G107940|TK1151|CDS

ATGGCCTCTTTCTCTGTTCCTTGCCCCAAGACTTCCGCCCTACTCGCACCTCACTCCAACCCTAAGCAAAACCCCAACCACCGTAACACCTCCATTCTCCTCTTCAAATCCGATTTCAAACACCTCCGCGCTTTGGTTTCAGGATCACCGTCTCACGGATTTCAGGCAACTAAGAGGAACCAGAATGGTGTTATGAAAGTGTCTGCTCAACTCAATGAGATTTCTATTGGGGAATCGTCAAATTCTGGACCACTATCAGA...

Protein

Download Protein FASTA

277 aa · TkA08G107940|TK1151|PROTEIN

MASFSVPCPKTSALLAPHSNPKQNPNHRNTSILLFKSDFKHLRALVSGSPSHGFQATKRNQNGVMKVSAQLNEISIGESSNSGPLSEDSDESSNISSSETTVPDVESITAFMNQVAGLVELVDSRDIMELKLKQEDREVIIRKKEALAPPPMVMMQSQQPQAMYHSQPSPQQAATPPPSAAAPPASPPALLPPAKPKSSRPPLKSPMAGTFYRAPAPGAPSFVKVGDKVQKGQVICIIEAMKLMNEIEADQSGTVVDIIA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G107940`
TK1151 ID	TkA08G107940
OH-1004 ID	LXL04_031462
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.300
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G107940

Location Chr08:28074900-28079353 (+)

Description Similar to BCCP2: Biotin carboxyl carrier protein of acetyl-CoA carboxylase 2, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g16390`	This protein is a component of the acetyl coenzyme A carboxylase complex; first, biotin carboxylase catalyzes the carboxylation of the carrier protein and then the transcarboxylase transfers the carboxyl group to form malonyl-CoA.	No verified direct reference in this release
`At5g15530`	This protein is a component of the acetyl coenzyme A carboxylase complex; first, biotin carboxylase catalyzes the carboxylation of the carrier protein and then the transcarboxylase transfers the carboxyl group to form malonyl-CoA.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031462 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006633 fatty acid biosynthetic process Biological Process

GO:2001295 malonyl-CoA biosynthetic process Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009317 acetyl-CoA carboxylase complex Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0009941 chloroplast envelope Cellular Component

GO:0003989 acetyl-CoA carboxylase activity Molecular Function

GO:0009374 biotin binding Molecular Function

GO:0060090 molecular adaptor activity Molecular Function

KEGG gene cross-reference

ath:AT5G15530

ath:AT5G16390

ecj:JW3223

eco:b3255

ecoc:C3026_17710

gmx:548072

sfl:SF3293

sfx:S3510

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.981

Rank 1 · TkA08G107940 · TK1151

Mitochondrion0.025

Rank 2 · TkA08G107940 · TK1151

Nucleus0.024

Rank 3 · TkA08G107940 · TK1151

Cytoplasm0.019

Rank 4 · TkA08G107940 · TK1151

Cell membrane0.011

Rank 5 · TkA08G107940 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF27048EIN3_N56-73 aa

PF26018BSH_RND_rel64-113 aa

PF25973BSH_CzcB197-210 aa

PF00364Biotin_lipoyl203-275 aa

PF26018BSH_RND_rel213-255 aa

PF13375RnfC_N221-260 aa

PF25984BSH_YknX222-260 aa

PF07831PYNP_C222-238 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G107940	`PF27048`	EIN3_N	56	73	0.22	12.0
TkA08G107940	`PF26018`	BSH_RND_rel	64	113	0.0016	19.0
TkA08G107940	`PF25973`	BSH_CzcB	197	210	0.02	15.5
TkA08G107940	`PF00364`	Biotin_lipoyl	203	275	1.6e-24	86.2
TkA08G107940	`PF26018`	BSH_RND_rel	213	255	0.0016	19.0
TkA08G107940	`PF13375`	RnfC_N	221	260	4.5e-05	24.1
TkA08G107940	`PF25984`	BSH_YknX	222	260	0.014	15.9
TkA08G107940	`PF07831`	PYNP_C	222	238	0.26	11.7
TkA08G107940	`PF25997`	BSH_YhbJ	223	264	0.18	12.6
TkA08G107940	`PF01597`	GCV_H	224	258	0.004	17.8
TkA08G107940	`PF25973`	BSH_CzcB	224	244	0.02	15.5
TkA08G107940	`PF27048`	EIN3_N	239	267	0.22	12.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q42533`	Arabidopsis thaliana	sp\|Q42533\|BCCP1_ARATH Biotin carboxyl carrier protein of acetyl-CoA carboxylase 1, chloroplastic	46.800%	Swiss-Prot	Medium
`Q9LLC1`	Arabidopsis thaliana	sp\|Q9LLC1\|BCCP2_ARATH Biotin carboxyl carrier protein of acetyl-CoA carboxylase 2, chloroplastic	64.600%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card