TkA08G107670 | RubberDandelionOmics

Gene overview

TkA08G107670

Reference: TK1151 Chr: Chr08 Coordinates: 28000609-28004299 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3604 bp · TkA08G107670|TK1151|cDNA

GCGAGCTCTCTGTTTCCATTAAAGTCTCGTATTTGTAATATACTCTTCCATATCACCTTCTCTATCTACCTTTTCTGATTAATTTCATTTTTTTAACTAATCACAAACACCAACCTCTTAAATTATTCACTAAAGAAGAAGAAGAAGAAGAAGCATGTTACAGTAATTAACCATGGCAGCAAAGAGGATTACAATGATCCTTTTCCTGATTTTAATCTCAGGAAAGGATGCAATTGGAGACTCGCTGGATTCCGATAAGG...

CDS

Download CDS FASTA

3249 bp · TkA08G107670|TK1151|CDS

ATGGCAGCAAAGAGGATTACAATGATCCTTTTCCTGATTTTAATCTCAGGAAAGGATGCAATTGGAGACTCGCTGGATTCCGATAAGGAAGTACTTCTCAATCTCAAGTCATTTTTGGAACAAAAGAACAAAGTGAATCAAGGAGACTATAGGAAATGGGACCCGCTATCTCAGACGCCGTGCAATTGGCCGGGGATTTCGTGTTCCGGGAATCGAGTAACCGGAATCAGCCTCCCTGACAACGACATAGCTGGTAATTT...

Protein

Download Protein FASTA

1082 aa · TkA08G107670|TK1151|PROTEIN

MAAKRITMILFLILISGKDAIGDSLDSDKEVLLNLKSFLEQKNKVNQGDYRKWDPLSQTPCNWPGISCSGNRVTGISLPDNDIAGNFFGNFSALTELTHLDLSTNTIDGTIPPDLGSCRNLKALNLSHNIIGGELNLTGLSSLEIIDLSMNRFSGDIMMSIPRVCDALVVANLSANHFTGEITTSMDVCPKLEYVDVSSNLLTGNLWFGINRFTEFSVSENIVNGTLPAWIFRENCSLQALDLSGNALVGGIPKEISNCR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G107670`
TK1151 ID	TkA08G107670
OH-1004 ID	LXL04_031452
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G107670

Location Chr08:28000609-28004299 (+)

Description Similar to At1g74360: Probable LRR receptor-like serine/threonine-protein kinase At1g74360

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g74360`	Probable LRR receptor-like serine/threonine-protein kinase At1g74360.	No verified direct reference in this release
`At3g13380`	Receptor with a dual specificity kinase activity acting on both serine/threonine- and tyrosine-containing substrates.	BRL1 and BRL3 are novel brassinosteroid receptors that function in vascular differentiation in Arabidopsis.2004 · DOI: 10.1242/dev.01403
`At4g39400`	Receptor with a dual specificity kinase activity acting on both serine/threonine- and tyrosine-containing substrates.	Brassinosteroid-insensitive dwarf mutants of Arabidopsis accumulate brassinosteroids.1999 · DOI: 10.1104/pp.121.3.743 Brassinosteroid-insensitive-1 is a ubiquitously expressed leucine-rich repeat receptor serine/threonine kinase.2000 · DOI: 10.1104/pp.123.4.1247 The Arabidopsis transthyretin-like protein is a potential substrate of BRASSINOSTEROID-INSENSITIVE 1.2004 · DOI: 10.1105/tpc.104.023903 The Arabidopsis thaliana brassinosteroid receptor (AtBRI1) contains a domain that functions as a guanylyl cyclase in vitro.2007 · DOI: 10.1371/journal.pone.0000449 BSKs mediate signal transduction from the receptor kinase BRI1 in Arabidopsis.2008 · DOI: 10.1126/science.1156973 Tyrosine phosphorylation of the BRI1 receptor kinase emerges as a component of brassinosteroid signaling in Arabidopsis.2009 · DOI: 10.1073/pnas.0810249106 BSKs are partially redundant positive regulators of brassinosteroid signaling in Arabidopsis.2013 · DOI: 10.1111/tpj.12175
`At1g55610`	Receptor with a serine/threonine-protein kinase activity.	BRL1, a leucine-rich repeat receptor-like protein kinase, is functionally redundant with BRI1 in regulating Arabidopsis brassinosteroid signaling.2004 · DOI: 10.1111/j.1365-313x.2004.02214.x BRL1 and BRL3 are novel brassinosteroid receptors that function in vascular differentiation in Arabidopsis.2004 · DOI: 10.1242/dev.01403

Rice

Reference gene ID	Possible function	Papers / DOI
`Os09g0293500`	May be involved in brassenosteroid (BR) perception in roots.	The role of OsBRI1 and its homologous genes, OsBRL1 and OsBRL3, in rice.2006 · DOI: 10.1104/pp.105.072330

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031452 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0001578 microtubule bundle formation Biological Process

GO:0002215 defense response to nematode Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009416 response to light stimulus Biological Process

GO:0009647 skotomorphogenesis Biological Process

GO:0009729 detection of brassinosteroid stimulus Biological Process

GO:0009742 brassinosteroid mediated signaling pathway Biological Process

GO:0009755 hormone-mediated signaling pathway Biological Process

GO:0009791 post-embryonic development Biological Process

GO:0009825 multidimensional cell growth Biological Process

GO:0009845 seed germination Biological Process

GO:0009911 positive regulation of flower development Biological Process

KEGG gene cross-reference

ath:AT1G55610

ath:AT1G74360

ath:AT4G39400

sly:101261320

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.868

Rank 1 · TkA08G107670 · TK1151

Endoplasmic reticulum0.084

Rank 2 · TkA08G107670 · TK1151

Cytoplasm0.067

Rank 3 · TkA08G107670 · TK1151

Nucleus0.047

Rank 4 · TkA08G107670 · TK1151

Lysosome / Vacuole0.025

Rank 5 · TkA08G107670 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08263LRRNT_226-69 aa

PF00560LRR_167-79 aa

PF12799LRR_467-107 aa

PF29594LRR_SKP273-181 aa

PF13855LRR_877-129 aa

PF23211LRR_LRWD179-153 aa

PF29247LRR_MHP1-HER1-GIP384-105 aa

PF25013LRR_Zer-190-106 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G107670	`PF08263`	LRRNT_2	26	69	8.3e-07	29.9
TkA08G107670	`PF00560`	LRR_1	67	79	6e-43	136.2
TkA08G107670	`PF12799`	LRR_4	67	107	1.4e-32	111.7
TkA08G107670	`PF29594`	LRR_SKP2	73	181	0.0036	17.3
TkA08G107670	`PF13855`	LRR_8	77	129	3.8e-35	120.2
TkA08G107670	`PF23211`	LRR_LRWD1	79	153	2.5e-05	24.8
TkA08G107670	`PF29247`	LRR_MHP1-HER1-GIP3	84	105	0.17	11.8
TkA08G107670	`PF25013`	LRR_Zer-1	90	106	7.1e-10	39.9
TkA08G107670	`PF23598`	LRR_14	93	242	1.1e-28	100.8
TkA08G107670	`PF24758`	LRR_At5g56370	93	196	4.7e-05	23.9
TkA08G107670	`PF00560`	LRR_1	97	118	6e-43	136.2
TkA08G107670	`PF13516`	LRR_6	97	109	4.2e-11	42.7
TkA08G107670	`PF24141`	LRR_ComC	99	112	0.052	13.9
TkA08G107670	`PF13516`	LRR_6	118	134	4.2e-11	42.7
TkA08G107670	`PF00560`	LRR_1	120	135	6e-43	136.2
TkA08G107670	`PF12799`	LRR_4	120	154	1.4e-32	111.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`C0LGJ1`	Arabidopsis thaliana	sp\|C0LGJ1\|Y1743_ARATH Probable LRR receptor-like serine/threonine-protein kinase At1g74360	62.100%	Swiss-Prot	High
`Q9LJF3`	Arabidopsis thaliana	sp\|Q9LJF3\|BRL3_ARATH Receptor-like protein kinase BRI1-like 3	38.300%	Swiss-Prot	Medium
`O22476`	Arabidopsis thaliana	sp\|O22476\|BRI1_ARATH Protein BRASSINOSTEROID INSENSITIVE 1	39.200%	Swiss-Prot	Low
`Q9ZWC8`	Arabidopsis thaliana	sp\|Q9ZWC8\|BRL1_ARATH Serine/threonine-protein kinase BRI1-like 1	40.900%	Swiss-Prot	Low
`Q69JN6`	Oryza sativa subsp. japonica	sp\|Q69JN6\|BRL1_ORYSJ Brassinosteroid LRR receptor kinase BRL1	39.800%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card