TkA08G106940 | RubberDandelionOmics

Gene overview

TkA08G106940

Reference: TK1151 Chr: Chr08 Coordinates: 27841185-27842562 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1226 bp · TkA08G106940|TK1151|cDNA

TTAAGGACTGATTCGGATTTTAGCAATAGTTTAGACACCAATAACGAAATTTCGTCTATTTGCACACCACATTTCATCATCGTTGCCTGGTTAGAAACTCCTAGAGATGCAGGAAACTGTCCTCAGCTCACAATGGCAGCCGAAGAAGAAGACGAACAACGCATCGTATTTGGGCGTTCCGATGGGTTAATTGAATGGGAACGACTCCAATTACGTCCCATTTCCGATCAATTTCAGTTTCATTCTCAGTCTCAATCTCC...

CDS

Download CDS FASTA

810 bp · TkA08G106940|TK1151|CDS

TTAAGGACTGATTCGGATTTTAGCAATAGTTTAGACACCAATAACGAAATTTCGTCTATTTGCACACCACATTTCATCATCGTTGCCTGGTTAGAAACTCCTAGAGATGCAGGAAACTGTCCTCAGCTCACAATGGCAGCCGAAGAAGAAGACGAACAACGCATCGTATTTGGGCGTTCCGATGGGTTAATTGAATGGGAACGACTCCAATTACGTCCCATTTCCGATCAATTTCAGTTTCATTCTCAGTCTCAATCTCC...

Protein

Download Protein FASTA

269 aa · TkA08G106940|TK1151|PROTEIN

LRTDSDFSNSLDTNNEISSICTPHFIIVAWLETPRDAGNCPQLTMAAEEEDEQRIVFGRSDGLIEWERLQLRPISDQFQFHSQSQSPPLSDPLGGGEVWSTIHEDYQPSVVFPPVNHEGIHLHLHHHQDVREIDTERSIPPSPISSPRARARPAGMAESVAAGWWDAGLEVLRFKFASVISFLRCVSASRGGSLRSHFPLAGSMVLLLLLYLRHRRRRRLKRESIIALISVIKEKDEKIHQLLHQIARMNELLLATHHGV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G106940`
TK1151 ID	TkA08G106940
OH-1004 ID	LXL04_031442
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	99.600
Protein coverage (%)	TK1151 100.000 / OH-1004 60.586 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA08G106940`
Location	Chr08:27841185-27842562 (-)
Description	Similar to GATL9: Probable galacturonosyltransferase-like 9
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_031442` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006979 response to oxidative stress Biological Process GO:0045489 pectin biosynthetic process Biological Process GO:0071555 cell wall organization Biological Process GO:0000139 Golgi membrane Cellular Component GO:0005576 extracellular region Cellular Component GO:0005794 Golgi apparatus Cellular Component GO:0009507 chloroplast Cellular Component GO:0047262 polygalacturonate 4-alpha-galacturonosyltransferase activity Molecular Function
KEGG gene cross-reference	ath:AT1G24170 ath:AT1G70090 ath:AT3G28340 ath:AT3G62660 ath:AT4G02130 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.427

Rank 1 · TkA08G106940 · TK1151

Endoplasmic reticulum0.271

Rank 2 · TkA08G106940 · TK1151

Cytoplasm0.227

Rank 3 · TkA08G106940 · TK1151

Cell membrane0.147

Rank 4 · TkA08G106940 · TK1151

Plastid0.076

Rank 5 · TkA08G106940 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05393Hum_adeno_E3A198-242 aa

PF20705DUF6821207-264 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G106940	`PF05393`	Hum_adeno_E3A	198	242	0.16	12.9
TkA08G106940	`PF20705`	DUF6821	207	264	0.038	14.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card