TkA08G104240 | RubberDandelionOmics

Gene overview

TkA08G104240

Reference: TK1151 Chr: Chr08 Coordinates: 27051494-27055646 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2975 bp · TkA08G104240|TK1151|cDNA

AAGACACATGAGAGATTTGAGGAGAAAGATGCGGTCCTTTTGGGTTCAATGCCCTCAAAAATCTTTGCTTGTGTACAACACAAACTGATTTCCCCCTTTTTGCCCTAATTTCTTCTTCCTTAAACTTCACCCCTTTCAACCCTAATGTTCTCTTGATTTTGCACGCAATTGCCCAAATTTCTCACATACCTGCTCTTCAATTTTGAAAAATCCCTTTAATTTTTACCCAAATTTGCATTCCCTATTTGATTCTTTCTCTA...

CDS

Download CDS FASTA

1419 bp · TkA08G104240|TK1151|CDS

ATGGCAATACCTCCAGTTACTCGAATGGCATTAGGAAGAAACACATGGGTTACTGTTCTATGCAGAAAGCTTAGAGATTGGTGGCACTGGGTGGCAGAGGGGGAATTACCTATTGTTGCAGCACAAGGGGCGGAAGTTGAAACATATAACACCCTTGATCCTAGTATTCGTGTGATCATATTAAAAGCCTTATGTGATATTCGTGTTGAGCAAGAAGATATAAGAGGCTATATAGAGGACTCTATAAAACACGGTGTTCC...

Protein

Download Protein FASTA

472 aa · TkA08G104240|TK1151|PROTEIN

MAIPPVTRMALGRNTWVTVLCRKLRDWWHWVAEGELPIVAAQGAEVETYNTLDPSIRVIILKALCDIRVEQEDIRGYIEDSIKHGVPLSAFRKERTGGDSHGVSYWYEDDPIIGQRLYREIRTVEVKKGKGKNVQSDPSYQWETISTNLDEFQDVSEKLSSSKNRMEASMGKKLENDIIPEVEKVHKRKEKLLKRQHRQALLLDSMIIDALGPGRSLRGRKPVSYTFDDYDRSINEAIKITKERKEVTPEPSLRREGLRN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G104240`
TK1151 ID	TkA08G104240
OH-1004 ID	LXL04_031381
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	97.400
Protein coverage (%)	TK1151 89.831 / OH-1004 58.003 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G104240

Location Chr08:27051494-27055646 (+)

Description Similar to DDR4: DDT domain-containing protein DDR4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g18950`	Probable transcription regulator.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031381 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006338 chromatin remodeling Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0007010 cytoskeleton organization Biological Process

GO:0007338 single fertilization Biological Process

GO:0016192 vesicle-mediated transport Biological Process

GO:0031507 heterochromatin formation Biological Process

GO:0061640 cytoskeleton-dependent cytokinesis Biological Process

GO:0000791 euchromatin Cellular Component

GO:0005634 nucleus Cellular Component

GO:0031010 ISWI-type complex Cellular Component

GO:0031213 RSF complex Cellular Component

KEGG gene cross-reference

ath:AT1G18950

hsa:27443

mmu:330409

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.946

Rank 1 · TkA08G104240 · TK1151

Cytoplasm0.164

Rank 2 · TkA08G104240 · TK1151

Mitochondrion0.021

Rank 3 · TkA08G104240 · TK1151

Cell membrane0.020

Rank 4 · TkA08G104240 · TK1151

Endoplasmic reticulum0.009

Rank 5 · TkA08G104240 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23450KIAA2026_hel14-33 aa

PF15612WHIM144-79 aa

PF23450KIAA2026_hel46-72 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G104240	`PF23450`	KIAA2026_hel	14	33	0.14	13.1
TkA08G104240	`PF15612`	WHIM1	44	79	0.00078	19.7
TkA08G104240	`PF23450`	KIAA2026_hel	46	72	0.14	13.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4IDY7`	Arabidopsis thaliana	sp\|F4IDY7\|DDR4_ARATH DDT domain-containing protein DDR4	61.400%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card