TkA08G102360 | RubberDandelionOmics

Gene overview

TkA08G102360

Reference: TK1151 Chr: Chr08 Coordinates: 26524869-26526966 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

747 bp · TkA08G102360|TK1151|cDNA

ATGTCCGGACTCCGGAATCTTCCTAATGCACAGATACAATTGGAAAGAAAAGAAGCTGAACGAGCTGGAACGGCTGAAGAGTCCCCTGTAGTTACTCCATTAATGGAATTTATTCGCCAGCAAAGAGCTGCCAAGGGTGGACCTCGGTATGTCCCGAGGAATAATTGTGGGAAGGGTAGTAGAAGTGGTAAAGAAAAGTCAACATATGTTCAGATAACCAATGGTTTGTCGTCTGTTAAATATGTGGGGTCCCCTAAACA...

CDS

Download CDS FASTA

747 bp · TkA08G102360|TK1151|CDS

ATGTCCGGACTCCGGAATCTTCCTAATGCACAGATACAATTGGAAAGAAAAGAAGCTGAACGAGCTGGAACGGCTGAAGAGTCCCCTGTAGTTACTCCATTAATGGAATTTATTCGCCAGCAAAGAGCTGCCAAGGGTGGACCTCGGTATGTCCCGAGGAATAATTGTGGGAAGGGTAGTAGAAGTGGTAAAGAAAAGTCAACATATGTTCAGATAACCAATGGTTTGTCGTCTGTTAAATATGTGGGGTCCCCTAAACA...

Protein

Download Protein FASTA

248 aa · TkA08G102360|TK1151|PROTEIN

MSGLRNLPNAQIQLERKEAERAGTAEESPVVTPLMEFIRQQRAAKGGPRYVPRNNCGKGSRSGKEKSTYVQITNGLSSVKYVGSPKHLRRRGPQENLQSLSLEVEFWFLVLSVSSFMNELVSSDLESKRRLFLPVYLEKEDLLTWVLDLIVLIRRHDFSKSLFNDQTVIVCDQCEREYHIRCLREHKMADLEALPKGRWFCKEDCERIHYVLQDLLIREPEIVHEELLTFVRKKEKEKEKEKGERKRK

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G102360`
TK1151 ID	TkA08G102360
OH-1004 ID	LXL04_031342
Relationship / confidence	Multi Candidate From Tk1151 / Complex relationship
Protein identity (%)	97.800
Protein coverage (%)	TK1151 93.145 / OH-1004 78.571 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G102360

Location Chr08:26524869-26526966 (+)

Description Similar to UPF3: Regulator of nonsense transcripts UPF3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g33980`	Recruits UPF2 at the cytoplasmic side of the nuclear envelope and the subsequent formation of an UPF1-UPF2-UPF3 surveillance complex (including UPF1 bound to release factors at the stalled ribosome) is believed to activate NMD.	UPF3 suppresses aberrant spliced mRNA in Arabidopsis.2005 · DOI: 10.1111/j.1365-313x.2005.02473.x Genome-wide suppression of aberrant mRNA-like noncoding RNAs by NMD in Arabidopsis.2009 · DOI: 10.1073/pnas.0808902106 Extensive coupling of alternative splicing of pre-mRNAs of serine/arginine (SR) genes with nonsense-mediated decay.2010 · DOI: 10.1111/j.1469-8137.2009.03065.x Nonsense-mediated mRNA decay factors, UPF1 and UPF3, contribute to plant defense.2011 · DOI: 10.1093/pcp/pcr144 Alternative splicing and nonsense-mediated decay modulate expression of important regulatory genes in Arabidopsis.2012 · DOI: 10.1093/nar/gkr932 Arabidopsis plants having defects in nonsense-mediated mRNA decay factors UPF1, UPF2, and UPF3 show photoperiod-dependent phenotypes in development and stress responses.2012 · DOI: 10.1111/j.1744-7909.2012.01093.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031342 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000184 nuclear-transcribed mRNA catabolic process, nonsense-mediated decay Biological Process

GO:0009611 response to wounding Biological Process

GO:0009863 salicylic acid mediated signaling pathway Biological Process

GO:0009867 jasmonic acid mediated signaling pathway Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0045727 positive regulation of translation Biological Process

GO:0048571 long-day photoperiodism Biological Process

GO:0051028 mRNA transport Biological Process

GO:0005634 nucleus Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0003729 mRNA binding Molecular Function

KEGG gene cross-reference

ath:AT1G33980

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.732

Rank 1 · TkA08G102360 · TK1151

Cytoplasm0.274

Rank 2 · TkA08G102360 · TK1151

Mitochondrion0.049

Rank 3 · TkA08G102360 · TK1151

Cell membrane0.043

Rank 4 · TkA08G102360 · TK1151

Endoplasmic reticulum0.027

Rank 5 · TkA08G102360 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF27108PHD_Pygo136-148 aa

PF23412zf_RING_Vps8160-201 aa

PF27108PHD_Pygo160-202 aa

PF00628PHD164-203 aa

PF22908PHD_NSD164-201 aa

PF00130C1_1167-187 aa

PF14446Prok-RING_1167-184 aa

PF23011PHD-1st_NSD169-203 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G102360	`PF27108`	PHD_Pygo	136	148	0.36	11.7
TkA08G102360	`PF23412`	zf_RING_Vps8	160	201	0.037	14.6
TkA08G102360	`PF27108`	PHD_Pygo	160	202	0.36	11.7
TkA08G102360	`PF00628`	PHD	164	203	2.9e-06	27.9
TkA08G102360	`PF22908`	PHD_NSD	164	201	0.0098	16.9
TkA08G102360	`PF00130`	C1_1	167	187	0.064	13.8
TkA08G102360	`PF14446`	Prok-RING_1	167	184	0.11	13.3
TkA08G102360	`PF23011`	PHD-1st_NSD	169	203	0.16	12.9
TkA08G102360	`PF26235`	zf-KKT2_KKT3	171	177	0.11	13.3
TkA08G102360	`PF26235`	zf-KKT2_KKT3	180	210	0.11	13.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FVW4`	Arabidopsis thaliana	sp\|Q9FVW4\|RENT3_ARATH Regulator of nonsense transcripts UPF3	65.100%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card