TkA08G099180 | RubberDandelionOmics

Gene overview

TkA08G099180

Reference: TK1151 Chr: Chr08 Coordinates: 25709180-25715971 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3822 bp · TkA08G099180|TK1151|cDNA

AAAAAAAGGAGTTGCGGTAAAATTTGGGAGTATTTCTGGTTTATAGATTCCCCAATTTTATATTGGAGCGAAATAGATAGGACACCTCGGGGAAACCAATATTGTTGAACTGCTACAGCTCTTCATCTTTGAATTCCGAAAGGAAGCTGCGAAAATATGGAGATGGAAGTAAGAGCAGTGGCAGGATTGGAAGGATGCTACGTTTCACTACCACTTCATCTGATTCAAACTCTTCAATCAACTTCTTCTGCTTCTCTGTT...

CDS

Download CDS FASTA

3426 bp · TkA08G099180|TK1151|CDS

ATGGAGATGGAAGTAAGAGCAGTGGCAGGATTGGAAGGATGCTACGTTTCACTACCACTTCATCTGATTCAAACTCTTCAATCAACTTCTTCTGCTTCTCTGTTTTCTTTTCTAGCTCTTGAGCTTCGGTCAATCACAAACAATAATGATGTCTGGTACGTTGCTTGGTCTGGCTCCGCATCCTCTAGCTCTTCAGCAATTGAGATTGCTCAGCAATTTGCAGAATGTCTTCATCTGCCAGATCATACAACTGTTCGAAT...

Protein

Download Protein FASTA

1141 aa · TkA08G099180|TK1151|PROTEIN

MEMEVRAVAGLEGCYVSLPLHLIQTLQSTSSASLFSFLALELRSITNNNDVWYVAWSGSASSSSSAIEIAQQFAECLHLPDHTTVRIKAIPSLPKAKSVTIEPDTEDDWEVLELNAEHAEAAILKQAGIVHEGMRFPLWLHGHTTITFSVVSTDPKEPMVQLVPGTEVCVAPKRRRRSENSVVKALLRIQDGDSRFFHKLRVNDIEMGVVLTSAVFIHPETADVFSLDSLQHVVLEQRLVKKEKKANSTPKEVDNGVPTK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G099180`
TK1151 ID	TkA08G099180
OH-1004 ID	LXL04_031279
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	93.100
Protein coverage (%)	TK1151 98.861 / OH-1004 98.800 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G099180

Location Chr08:25709180-25715971 (-)

Description Similar to PEX1: Peroxisome biogenesis protein 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g08470`	Component of the PEX1-PEX6 AAA ATPase complex, a protein dislocase complex that mediates the ATP-dependent extraction of the PEX5 receptor from peroxisomal membranes, an essential step for PEX5 recycling.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031279 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006625 protein targeting to peroxisome Biological Process

GO:0006635 fatty acid beta-oxidation Biological Process

GO:0007031 peroxisome organization Biological Process

GO:0016558 protein import into peroxisome matrix Biological Process

GO:0016562 protein import into peroxisome matrix, receptor recycling Biological Process

GO:0043335 protein unfolding Biological Process

GO:0060152 microtubule-based peroxisome localization Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005777 peroxisome Cellular Component

GO:0005778 peroxisomal membrane Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

KEGG gene cross-reference

ath:AT5G08470

hsa:5189

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.329

Rank 1 · TkA08G099180 · TK1151

Cytoplasm0.294

Rank 2 · TkA08G099180 · TK1151

Peroxisome0.167

Rank 3 · TkA08G099180 · TK1151

Endoplasmic reticulum0.088

Rank 4 · TkA08G099180 · TK1151

Mitochondrion0.088

Rank 5 · TkA08G099180 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF09262PEX-1N97-172 aa

PF09848SLFN-g3_helicase257-301 aa

PF13555AAA_29551-569 aa

PF01580FtsK_SpoIIIE551-570 aa

PF27394Aq_aa27552-641 aa

PF13191AAA_16553-597 aa

PF00580UvrD-helicase554-600 aa

PF06414Zeta_toxin555-585 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G099180	`PF09262`	PEX-1N	97	172	9.3e-27	93.9
TkA08G099180	`PF09848`	SLFN-g3_helicase	257	301	0.0023	18.0
TkA08G099180	`PF13555`	AAA_29	551	569	0.0055	17.2
TkA08G099180	`PF01580`	FtsK_SpoIIIE	551	570	0.18	12.0
TkA08G099180	`PF27394`	Aq_aa27	552	641	0.072	13.6
TkA08G099180	`PF13191`	AAA_16	553	597	1.1e-14	56.0
TkA08G099180	`PF00580`	UvrD-helicase	554	600	0.038	14.4
TkA08G099180	`PF06414`	Zeta_toxin	555	585	0.11	12.7
TkA08G099180	`PF24389`	ORC-CDC6-like	555	571	0.27	10.6
TkA08G099180	`PF13401`	AAA_22	556	609	2.8e-07	31.6
TkA08G099180	`PF05496`	RuvB_N	556	582	3.5e-07	30.8
TkA08G099180	`PF20720`	nSTAND3	556	583	1.2e-05	25.8
TkA08G099180	`PF00931`	NB-ARC	556	602	9.5e-05	22.7
TkA08G099180	`PF07728`	AAA_5	557	580	9.4e-08	32.9
TkA08G099180	`PF01078`	Mg_chelatase	557	581	2e-05	24.8
TkA08G099180	`PF12775`	AAA_7	557	589	4.8e-05	23.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FNP1`	Arabidopsis thaliana	sp\|Q9FNP1\|PEX1_ARATH Peroxisomal ATPase PEX1	57.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card