TkA08G098690 | RubberDandelionOmics

Gene overview

TkA08G098690

Reference: TK1151 Chr: Chr08 Coordinates: 25573675-25578158 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2045 bp · TkA08G098690|TK1151|cDNA

AAAACAAAAAGGCTTACTGCCACCCAGCCATCTCATCATTCCCCAAGCCGCCAAAAAGCTTATAAATACCCTCCTTCATCTTCCATTTAATTCACATATCCTCTCAATTTCAACTCCATTTCCATCTCCATTTGTAGATTATATCGAACATGGTTTCCTCCAGTAAGGATGATAAACAACCGCGGGCGCCGCTGGAAATGCAGCACCCCGACTTACCCCAAAGGCCTATATGGCAGATTATTATGGTCTCCGCCATCGCT...

CDS

Download CDS FASTA

1545 bp · TkA08G098690|TK1151|CDS

ATGGTTTCCTCCAGTAAGGATGATAAACAACCGCGGGCGCCGCTGGAAATGCAGCACCCCGACTTACCCCAAAGGCCTATATGGCAGATTATTATGGTCTCCGCCATCGCTGCCGGAGTCCAGTTCGGATGGGCCCTCCAGCTCTCCCTCCTCACCCCTTACGTCCAACTCCTGGGTATTCCCCACACCTGGTCGTCCTTCATCTGGCTCTGTGGTCCAATCTCCGGCATGATTGTTCAGCCTGTCGTCGGTTACTACAG...

Protein

Download Protein FASTA

514 aa · TkA08G098690|TK1151|PROTEIN

MVSSSKDDKQPRAPLEMQHPDLPQRPIWQIIMVSAIAAGVQFGWALQLSLLTPYVQLLGIPHTWSSFIWLCGPISGMIVQPVVGYYSDRCTSRFGRRRPFIAGGALLVAIAVFLIGYAADIGVSTGDKIGARTKPRAVAIFVVGFWILDVANNTLQGPCRALLADLSGANSSKIRTGNAMFAFFMGVGNVLGYAAGSYTHLYTFVPFTKTAACDVYCANLKTCFFISIALLVTITVIALATVSEDVFVPEAVEKSSDGKQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G098690`
TK1151 ID	TkA08G098690
OH-1004 ID	LXL04_031088
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	50.500
Protein coverage (%)	TK1151 92.023 / OH-1004 92.698 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G098690

Location Chr08:25573675-25578158 (+)

Description Similar to SUC4: Sucrose transport protein SUC4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g22710`	Responsible for the transport of sucrose into the cell, with the concomitant uptake of protons (symport system).	Genetic evidence for the in planta role of phloem-specific plasma membrane sucrose transporters.2000 · DOI: 10.1073/pnas.250473797 Substrate specificity of the Arabidopsis thaliana sucrose transporter AtSUC2.2003 · DOI: 10.1074/jbc.m308490200 SUC1 and SUC2: two sucrose transporters from Arabidopsis thaliana; expression and characterization in baker's yeast and identification of the histidine-tagged protein.1994 · DOI: 10.1046/j.1365-313x.1994.6010067.x
`At1g71880`	Responsible for the transport of sucrose into the cell, with the concomitant uptake of protons (symport system).	The AtSUC1 sucrose carrier may represent the osmotic driving force for anther dehiscence and pollen tube growth in Arabidopsis.1999 · DOI: 10.1046/j.1365-313x.1999.00527.x Arabidopsis sucrose transporter AtSUC1 is important for pollen germination and sucrose-induced anthocyanin accumulation.2008 · DOI: 10.1104/pp.108.118992 SUC1 and SUC2: two sucrose transporters from Arabidopsis thaliana; expression and characterization in baker's yeast and identification of the histidine-tagged protein.1994 · DOI: 10.1046/j.1365-313x.1994.6010067.x A kinetic model with ordered cytoplasmic dissociation for SUC1, an Arabidopsis H+/sucrose cotransporter expressed in Xenopus oocytes.1997 · DOI: 10.1007/s002329900275
`At2g14670`	Responsible for the transport of sucrose into the cell, with the concomitant uptake of protons (symport system).	AtSUC8 and AtSUC9 encode functional sucrose transporters, but the closely related AtSUC6 and AtSUC7 genes encode aberrant proteins in different Arabidopsis ecotypes.2004 · DOI: 10.1111/j.1365-313x.2004.02196.x
`At1g66570`	May be responsible for the transport of glucosides into the cell, with the concomitant uptake of protons (symport system).	No verified direct reference in this release
`At5g43610`	May be responsible for the transport of glucosides into the cell, with the concomitant uptake of protons (symport system).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031088 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005985 sucrose metabolic process Biological Process

GO:0009908 flower development Biological Process

GO:0009909 regulation of flower development Biological Process

GO:0015768 maltose transport Biological Process

GO:0042946 glucoside transport Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005773 vacuole Cellular Component

GO:0005801 cis-Golgi network Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009705 plant-type vacuole membrane Cellular Component

GO:0005364 maltose:proton symporter activity Molecular Function

KEGG gene cross-reference

ath:AT1G09960

ath:AT1G22710

ath:AT5G06170

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.610

Rank 1 · TkA08G098690 · TK1151

Lysosome / Vacuole0.179

Rank 2 · TkA08G098690 · TK1151

Cytoplasm0.158

Rank 3 · TkA08G098690 · TK1151

Endoplasmic reticulum0.089

Rank 4 · TkA08G098690 · TK1151

Golgi apparatus0.069

Rank 5 · TkA08G098690 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13347MFS_242-291 aa

PF02764Diphtheria_T101-124 aa

PF02764Diphtheria_T166-198 aa

PF13347MFS_2419-495 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G098690	`PF13347`	MFS_2	42	291	1e-10	41.5
TkA08G098690	`PF02764`	Diphtheria_T	101	124	0.46	11.5
TkA08G098690	`PF02764`	Diphtheria_T	166	198	0.46	11.5
TkA08G098690	`PF13347`	MFS_2	419	495	1e-10	41.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q39231`	Arabidopsis thaliana	sp\|Q39231\|SUC2_ARATH Sucrose transport protein SUC2	65.700%	Swiss-Prot	High
`Q39232`	Arabidopsis thaliana	sp\|Q39232\|SUC1_ARATH Sucrose transport protein SUC1	64.000%	Swiss-Prot	High
`Q9ZVK6`	Arabidopsis thaliana	sp\|Q9ZVK6\|SUC8_ARATH Sucrose transport protein SUC8	66.200%	Swiss-Prot	High
`Q67YF8`	Arabidopsis thaliana	sp\|Q67YF8\|SUC7_ARATH Sucrose transport protein SUC7	64.000%	Swiss-Prot	High
`Q6A329`	Arabidopsis thaliana	sp\|Q6A329\|SUC6_ARATH Putative sucrose transport protein SUC6	65.000%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card