LXL04_031088 | RubberDandelionOmics

Gene overview

LXL04_031088

Reference: OH-1004 Chr: Chr07 Coordinates: 292287-295634 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1482 bp · LXL04_031088|LXL04_031088|OH1004|cDNA

ATGACGGTGCCGGAAAGTCAAACACAAAGGCACCGTTCTCGCGGTGGAGCGGCTGTTACTCCGGTGGAAACTCCAATTAGACTCCGGGTACTCTTCCGAGTGGCATCTGTTGCTTGTGGGATACAGTTTGGGTGGGCCTTACAACTCTCCCTATTAACTCCATATGTGCAAGAGCTCGGAATTCCTCACGCGTGGTCGAGCATCATATGGCTTTGTGGACCTCTATCGGGGTTTTTCGTTCAACCGCTGGCTGGACACAT...

CDS

Download CDS FASTA

1482 bp · LXL04_031088|LXL04_031088|OH1004|CDS

ATGACGGTGCCGGAAAGTCAAACACAAAGGCACCGTTCTCGCGGTGGAGCGGCTGTTACTCCGGTGGAAACTCCAATTAGACTCCGGGTACTCTTCCGAGTGGCATCTGTTGCTTGTGGGATACAGTTTGGGTGGGCCTTACAACTCTCCCTATTAACTCCATATGTGCAAGAGCTCGGAATTCCTCACGCGTGGTCGAGCATCATATGGCTTTGTGGACCTCTATCGGGGTTTTTCGTTCAACCGCTGGCTGGACACAT...

Protein

Download Protein FASTA

493 aa · LXL04_031088|LXL04_031088|OH1004|PROTEIN

MTVPESQTQRHRSRGGAAVTPVETPIRLRVLFRVASVACGIQFGWALQLSLLTPYVQELGIPHAWSSIIWLCGPLSGFFVQPLAGHMSDRSTSKYGRRRPFIVIGCASIIFSVLLIGYAADIGGLLGDRETKTRAIAVFIIGFWLLDMANNATQGPCRALLADLTGNDHRRTRVANAYYSLFMAIGNVLGYATGAYSGWYRVLPFTKNVACDINCANLKAAFLLDVVFIIVTTYISVTAIHEQPGTTVLPQDSSHPQEAF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_031088`
TK1151 ID	TkA08G098690
OH-1004 ID	LXL04_031088
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	50.500
Protein coverage (%)	TK1151 92.023 / OH-1004 92.698 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_031088

Location Chr07:292287-295634 (+)

Description Similar to SUC4: Sucrose transport protein SUC4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g09960`	Responsible for the transport of sucrose into the cell, with the concomitant uptake of protons (symport system).	A new subfamily of sucrose transporters, SUT4, with low affinity/high capacity localized in enucleate sieve elements of plants.2000 · DOI: 10.1105/tpc.12.8.1345
`At1g22710`	Responsible for the transport of sucrose into the cell, with the concomitant uptake of protons (symport system).	Genetic evidence for the in planta role of phloem-specific plasma membrane sucrose transporters.2000 · DOI: 10.1073/pnas.250473797 Substrate specificity of the Arabidopsis thaliana sucrose transporter AtSUC2.2003 · DOI: 10.1074/jbc.m308490200 SUC1 and SUC2: two sucrose transporters from Arabidopsis thaliana; expression and characterization in baker's yeast and identification of the histidine-tagged protein.1994 · DOI: 10.1046/j.1365-313x.1994.6010067.x
`At5g06170`	High-affinity sucrose transporter.	AtSUC8 and AtSUC9 encode functional sucrose transporters, but the closely related AtSUC6 and AtSUC7 genes encode aberrant proteins in different Arabidopsis ecotypes.2004 · DOI: 10.1111/j.1365-313x.2004.02196.x Arabidopsis sucrose transporter AtSUC9. High-affinity transport activity, intragenic control of expression, and early flowering mutant phenotype.2007 · DOI: 10.1104/pp.106.089003

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: A2ZN77`	Responsible for the transport of sucrose into the cell, with the concomitant uptake of protons (symport system).	No verified direct reference in this release
`Os12g0641400`	Responsible for the transport of sucrose into the cell, with the concomitant uptake of protons (symport system).	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031088 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0005985 sucrose metabolic process Biological Process

GO:0009908 flower development Biological Process

GO:0009909 regulation of flower development Biological Process

GO:0015768 maltose transport Biological Process

GO:0042946 glucoside transport Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005773 vacuole Cellular Component

GO:0005801 cis-Golgi network Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009705 plant-type vacuole membrane Cellular Component

GO:0005364 maltose:proton symporter activity Molecular Function

KEGG gene cross-reference

ath:AT1G09960

ath:AT1G22710

ath:AT5G06170

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.420

Rank 1 · LXL04_031088 · OH-1004

Lysosome / Vacuole0.294

Rank 2 · LXL04_031088 · OH-1004

Cytoplasm0.191

Rank 3 · LXL04_031088 · OH-1004

Endoplasmic reticulum0.117

Rank 4 · LXL04_031088 · OH-1004

Golgi apparatus0.095

Rank 5 · LXL04_031088 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07690.22MFS_14-121 aa

PF13347.13MFS_235-420 aa

PF07690.22MFS_136-439 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_031088	`PF07690.22`	MFS_1	4	121	1.6e-18	67.5
LXL04_031088	`PF13347.13`	MFS_2	35	420	7.1e-09	35.4
LXL04_031088	`PF07690.22`	MFS_1	36	439	1.6e-18	67.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FE59`	Arabidopsis thaliana	Sucrose transport protein SUC4	65.139%	Swiss-Prot	strong database homology
`Q39231`	Arabidopsis thaliana	Sucrose transport protein SUC2	50.515%	Swiss-Prot	strong database homology
`Q9FG00`	Arabidopsis thaliana	Sucrose transport protein SUC9	49.795%	Swiss-Prot	moderate database homology
`A2ZN77`	Oryza sativa subsp. indica	Sucrose transport protein SUT2	63.202%	Swiss-Prot	strong database homology
`Q0ILJ3`	Oryza sativa subsp. japonica	Sucrose transport protein SUT2	63.202%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card