Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1596 bp · TkA08G096070|TK1151|cDNA
AAACAATTGAAGGGAAATGGTTTTTATTTTTTCTTTTTGGGGCGCATTTGCATATAAGATGATTGGTGGGGAACATCGAAAGCTTTTGGTGGCCAAACTGGAAACCTGTAAAGCTTTTTGGTGGCGAGTTTAAAATTATGGAAAGCTTCAGGTGGCTAATGACTATTTCAAATTAAACTGTGAAAAAGAGGGAAGAATTTGTGCCGAAGCCTTCTTCCTGCTGCTTTGCCGCCGGCGAATATCAGAGGTGCTTGAAATTG...
1074 bp · TkA08G096070|TK1151|CDS
ATGTTGGAGGCTCGAAGTCTAAAGAAAGCAGTGGTTCCATCGACACTGATAGAGTACCCATCTCCTGCCAATCTTCAATCCAATCGCGTTTCCCTTCATGTTAGTGACGATGGAACTTCTTGCTGGGTTTATGTAGCTTCCGGTTGCCATATTTATAGACTCCTGGTCTCATTAGAAGATTCTTTAGTTGATGAAGGAAAGGATAGCCTCCTTATACCTGAACAAACTCAGGTTGTGGACTCTACTATAGTGAATCGCTG...
Protein
Download Protein FASTA357 aa · TkA08G096070|TK1151|PROTEIN
MLEARSLKKAVVPSTLIEYPSPANLQSNRVSLHVSDDGTSCWVYVASGCHIYRLLVSLEDSLVDEGKDSLLIPEQTQVVDSTIVNRCPHRSEIQTIVLNETESPDFLILGSVDSYGHLIVSRLDSDGKDVERLTFSISPRDFGIGESGWAGLCFSPSQWSTTAVAHSFGKSIDVFDQDLHLRTFRTLWYPTAVTFLQSGNESSTLAVTEGCQLSIWDLRVKENGGCVQRICGSVGNILYSVSNSSTGNIAVGGSDRTMTV...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA08G096070 |
|---|---|
| TK1151 ID | TkA08G096070 |
| OH-1004 ID | LXL04_031232 |
| Relationship / confidence | Rbh Below Probable Coverage Or Synteny Threshold / Review |
| Protein identity (%) | 100.000 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 69.052Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA08G096070 |
|---|---|
| Location | Chr08:24863998-24867201 (-) |
| Description | Similar to TIR1: Protein TRANSPORT INHIBITOR RESPONSE 1 |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0006511 ubiquitin-dependent protein catabolic process Biological Process GO:0006952 defense response Biological Process GO:0009733 response to auxin Biological Process GO:0009734 auxin-activated signaling pathway Biological Process GO:0009873 ethylene-activated signaling pathway Biological Process GO:0010152 pollen maturation Biological Process GO:0010311 lateral root formation Biological Process GO:0016036 cellular response to phosphate starvation Biological Process GO:0016567 protein ubiquitination Biological Process GO:0031146 SCF-dependent proteasomal ubiquitin-dependent protein catabolic process Biological Process GO:0045014 carbon catabolite repression of transcription by glucose Biological Process GO:0048443 stamen development Biological Process |
| KEGG gene cross-reference | ath:AT1G12820 ath:AT3G26810 ath:AT3G62980 ath:AT4G03190 dosa:Os04g0395600 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF00400WD4031-49 aaPF16225DUF488447-55 aaPF25173Beta-prop_WDR3_1st88-114 aaPF24807WD40_CDC20-Fz158-287 aaPF07569Hira189-222 aaPF00400WD40193-217 aaPF24814WD40_Prp19205-295 aaPF25174Beta-prop_THOC3207-320 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA08G096070 | PF00400 | WD40 | 31 | 49 | 0.43 | 12.0 |
| TkA08G096070 | PF16225 | DUF4884 | 47 | 55 | 0.0065 | 17.0 |
| TkA08G096070 | PF25173 | Beta-prop_WDR3_1st | 88 | 114 | 0.039 | 14.4 |
| TkA08G096070 | PF24807 | WD40_CDC20-Fz | 158 | 287 | 0.00041 | 20.4 |
| TkA08G096070 | PF07569 | Hira | 189 | 222 | 0.18 | 12.1 |
| TkA08G096070 | PF00400 | WD40 | 193 | 217 | 0.43 | 12.0 |
| TkA08G096070 | PF24814 | WD40_Prp19 | 205 | 295 | 0.023 | 14.5 |
| TkA08G096070 | PF25174 | Beta-prop_THOC3 | 207 | 320 | 9e-05 | 22.3 |
| TkA08G096070 | PF25173 | Beta-prop_WDR3_1st | 209 | 285 | 0.039 | 14.4 |
| TkA08G096070 | PF00400 | WD40 | 226 | 262 | 0.43 | 12.0 |
| TkA08G096070 | PF00400 | WD40 | 280 | 287 | 0.43 | 12.0 |
| TkA08G096070 | PF16225 | DUF4884 | 312 | 333 | 0.0065 | 17.0 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.