LXL04_031232 | RubberDandelionOmics

Gene overview

LXL04_031232

Reference: OH-1004 Chr: Chr07 Coordinates: 2874436-2881367 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1600 bp · LXL04_031232|LXL04_031232|OH1004|cDNA

ATTAAACTGTGAAAAAGAGGGAAGAATTTGTGCCGAAGCCTTCTTCCTGCTGCTTTGCCGCCGGCGAATATCAGAGGTGCTTGAAATTGGAGAACAGATGTTGGAGGCTCGAAGTCTAAAGAAAGCAGTGGTTCCATCGACACTGATAGAGTACCCATCTCCTGCCAATCTTCAATCCAATCGCGTTTCCCTTCATGTTAGTGACGATGGAACTTCTTGCTGGGTTTATGTAGCTTCCGGTTGCCATATTTATAGACTCC...

CDS

Download CDS FASTA

1554 bp · LXL04_031232|LXL04_031232|OH1004|CDS

CTGCTGCTTTGCCGCCGGCGAATATCAGAGGTGCTTGAAATTGGAGAACAGATGTTGGAGGCTCGAAGTCTAAAGAAAGCAGTGGTTCCATCGACACTGATAGAGTACCCATCTCCTGCCAATCTTCAATCCAATCGCGTTTCCCTTCATGTTAGTGACGATGGAACTTCTTGCTGGGTTTATGTAGCTTCCGGTTGCCATATTTATAGACTCCTGGTCTCATTAGAAGATTCTTTAGTTGATGAAGGAAAGGATAGCCT...

Protein

Download Protein FASTA

517 aa · LXL04_031232|LXL04_031232|OH1004|PROTEIN

MLLCRRRISEVLEIGEQMLEARSLKKAVVPSTLIEYPSPANLQSNRVSLHVSDDGTSCWVYVASGCHIYRLLVSLEDSLVDEGKDSLLIPEQTQVVDSTIVNRCPHRSEIQTIVLNETESPDFLILGSVDSYGHLIVSRLDSDGKDVERLTFSISPRDFGIGESGWAGLCFSPSQWSTTAVAHSFGKSIDVFDQDLHLRTFRTLWYPTAVTFLQSGNESSTLAVTEGCQLSIWDLRVKENGGCVQRICGSVGNILYSVSN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_031232`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_031232

Location Chr07:2874436-2881367 (-)

Description Similar to TIR1: Protein TRANSPORT INHIBITOR RESPONSE 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g62980`	Auxin receptor that mediates Aux/IAA proteins proteasomal degradation and auxin-regulated transcription.	Identification of an SCF ubiquitin-ligase complex required for auxin response in Arabidopsis thaliana.1999 · DOI: 10.1101/gad.13.13.1678 Five components of the ethylene-response pathway identified in a screen for weak ethylene-insensitive mutants in Arabidopsis.2003 · DOI: 10.1073/pnas.0438070100 The Arabidopsis F-box protein TIR1 is an auxin receptor.2005 · DOI: 10.1038/nature03542 A plant miRNA contributes to antibacterial resistance by repressing auxin signaling.2006 · DOI: 10.1126/science.1126088 Small-molecule agonists and antagonists of F-box protein-substrate interactions in auxin perception and signaling.2008 · DOI: 10.1073/pnas.0711146105 The TIR1 protein of Arabidopsis functions in auxin response and is related to human SKP2 and yeast grr1p.1998 · DOI: 10.1101/gad.12.2.198
`At1g12820`	Confers sensitivity to the virulent bacterial pathogen P.syringae (By similarity).	No verified direct reference in this release
`At4g03190`	Component of SCF(ASK-cullin-F-box) E3 ubiquitin ligase complexes, which may mediate the ubiquitination and subsequent proteasomal degradation of target proteins.	Cloning by pathway activation in yeast: identification of an Arabidopsis thaliana F-box protein that can turn on glucose repression.2002 · DOI: 10.1023/a:1014440531842
`At3g26810`	Component of SCF(ASK-cullin-F-box) E3 ubiquitin ligase complexes, which may mediate the ubiquitination and subsequent proteasomal degradation of target proteins.	A plant miRNA contributes to antibacterial resistance by repressing auxin signaling.2006 · DOI: 10.1126/science.1126088

Rice

Reference gene ID	Possible function	Papers / DOI
`Os04g0395600`	Transport inhibitor response 1-like protein Os04g0395600.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031232 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006511 ubiquitin-dependent protein catabolic process Biological Process

GO:0006952 defense response Biological Process

GO:0009733 response to auxin Biological Process

GO:0009734 auxin-activated signaling pathway Biological Process

GO:0009873 ethylene-activated signaling pathway Biological Process

GO:0010152 pollen maturation Biological Process

GO:0010311 lateral root formation Biological Process

GO:0016036 cellular response to phosphate starvation Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0031146 SCF-dependent proteasomal ubiquitin-dependent protein catabolic process Biological Process

GO:0045014 carbon catabolite repression of transcription by glucose Biological Process

GO:0048443 stamen development Biological Process

KEGG gene cross-reference

ath:AT1G12820

ath:AT3G26810

ath:AT3G62980

ath:AT4G03190

dosa:Os04g0395600

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.558

Rank 1 · LXL04_031232 · OH-1004

Cytoplasm0.338

Rank 2 · LXL04_031232 · OH-1004

Cell membrane0.069

Rank 3 · LXL04_031232 · OH-1004

Lysosome / Vacuole0.058

Rank 4 · LXL04_031232 · OH-1004

Golgi apparatus0.050

Rank 5 · LXL04_031232 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF18511.7F-box_5375-395 aa

PF18791.8Transp_inhibit415-461 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_031232	`PF18511.7`	F-box_5	375	395	1.9e-06	28.0
LXL04_031232	`PF18791.8`	Transp_inhibit	415	461	1.2e-25	89.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q570C0`	Arabidopsis thaliana	Protein TRANSPORT INHIBITOR RESPONSE 1	79.054%	Swiss-Prot	weak database homology
`Q9LPW7`	Arabidopsis thaliana	Protein AUXIN SIGNALING F-BOX 3	62.500%	Swiss-Prot	weak database homology
`Q9ZR12`	Arabidopsis thaliana	GRR1-like protein 1	67.123%	Swiss-Prot	weak database homology
`Q9LW29`	Arabidopsis thaliana	Protein AUXIN SIGNALING F-BOX 2	62.500%	Swiss-Prot	weak database homology
`Q7XVM8`	Oryza sativa subsp. japonica	Transport inhibitor response 1-like protein Os04g0395600	61.806%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card