RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA08G095760
Reference: TK1151 Chr: Chr08 Coordinates: 24767872-24769637 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1690 bp · TkA08G095760|TK1151|cDNA

AAATCGAACAACAAAAGTGTTTGGGGTTTCAAAACATTTTGATTTTTTCTTATTTTCATACCTCCGAAAATGACTTCACCGTGTCTCACAATCCAAATTCTTAATAATTTGTCTTCCTTCTCAGCCGTTGACTCCTTCTTCTCCTTCTCCTCTTCCCGTTAATGGCGGCTCACTTTCTGTATCTCTTTCTTCCCACTCGAACCCTTTCTATCTCCCTCTCCAAAATCCCCCAAATTTATCTCTCTTAATTACCATGAACG...

CDS

Download CDS FASTA

1140 bp · TkA08G095760|TK1151|CDS

ATGAACGCGACTCTCCAAGCGGTGCTCGCCGCCGTGGCCAGCTTCACCATCATCTCCCTCATCGTCTACTTCTTCTACTTCATCTGCCGGGCCACCAGAAATCGCCGCCGTGACCCGGAATCCCGACCCCGAACCAGAGCAATCCGAACCGTACGCAATTTCGATACATCAACGTCCTTCATCAGCGTCGCCGAGAGCCAGCTGTTTGACCAGTCGTTGAATCAGATCGAGATGTCTGACCTGGTCAAAGCTACGCGAAA...

Protein

Download Protein FASTA

379 aa · TkA08G095760|TK1151|PROTEIN

MNATLQAVLAAVASFTIISLIVYFFYFICRATRNRRRDPESRPRTRAIRTVRNFDTSTSFISVAESQLFDQSLNQIEMSDLVKATRNFSPDLIVGDGSFGLVYKANLPSGVTVAVKKLGADAFQGYREFRAEMETLGKIRHENIVKFFGYCATGTDRILIYEFIEKGSLDQWLYDTSSTHNDTVTVRLPLSWSTRINIIKGVAKGLAFMHNLDTAPIIHRDIKASNILLDEEFEAHIADFGLARRIDGSHSHVSTQVAGT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA08G095760
TK1151 IDTkA08G095760
OH-1004 IDLXL04_011873
Relationship / confidenceNon Reciprocal Best Hit / Complex relationship
Protein identity (%)47.200
Protein coverage (%)TK1151 81.003 / OH-1004 22.923
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA08G095760
LocationChr08:24767872-24769637 (+)
DescriptionSimilar to EMS1: Leucine-rich repeat receptor protein kinase EMS1
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At5g07280 Receptor with a serine/threonine-protein kinase activity required for the specification of the correct number of male archesporial initials and for the subsequent specification of tapetal and middle cell layer identities. No verified direct reference in this release
At5g53890 Phytosulfokine receptor with a serine/threonine-protein kinase activity. No verified direct reference in this release
At2g02220 Phytosulfokine receptor with both a serine/threonine-protein kinase activity and a guanylate cyclase activity.
Disruption and overexpression of Arabidopsis phytosulfokine receptor gene affects cellular longevity and potential for growth.2006 · DOI: 10.1104/pp.106.081109
The phytosulfokine (PSK) receptor is capable of guanylate cyclase activity and enabling cyclic GMP-dependent signaling in plants.2011 · DOI: 10.1074/jbc.m110.168823
The tyrosine-sulfated peptide receptors PSKR1 and PSY1R modify the immunity of Arabidopsis to biotrophic and necrotrophic pathogens in an antagonistic manner.2013 · DOI: 10.1111/tpj.12050

Rice

Reference gene IDPossible functionPapers / DOI
Os01g0917500 Receptor-like kinase that plays important roles in restricting the number of cells entering into male and female sporogenesis.
The MSP1 gene is necessary to restrict the number of cells entering into male and female sporogenesis and to initiate anther wall formation in rice.2003 · DOI: 10.1105/tpc.012401
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_011873 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0009554 megasporogenesis Biological Process
GO:0009556 microsporogenesis Biological Process
GO:0009611 response to wounding Biological Process
GO:0010234 anther wall tapetum cell fate specification Biological Process
GO:0042659 regulation of cell fate specification Biological Process
GO:0045184 establishment of protein localization Biological Process
GO:0046777 protein autophosphorylation Biological Process
GO:0048658 anther wall tapetum development Biological Process
GO:0051302 regulation of cell division Biological Process
GO:0055075 potassium ion homeostasis Biological Process
GO:0090708 specification of plant organ axis polarity Biological Process
GO:0160073 Casparian strip assembly Biological Process
KEGG gene cross-reference
ath:AT4G20140
ath:AT5G07280
dosa:Os01g0917500
dosa:Os02g0194400
osa:4324355
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.786
Rank 1 · TkA08G095760 · TK1151
Cytoplasm0.157
Rank 2 · TkA08G095760 · TK1151
Nucleus0.122
Rank 3 · TkA08G095760 · TK1151
Endoplasmic reticulum0.054
Rank 4 · TkA08G095760 · TK1151
Golgi apparatus0.027
Rank 5 · TkA08G095760 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02439Adeno_E3_CR28-35 aa
PF29279YLL006W-A9-29 aa
PF28423Epiregulin_C12-39 aa
PF00069Pkinase93-368 aa
PF07714PK_Tyr_Ser-Thr94-370 aa
PF03109ABC194-117 aa
PF29279YLL006W-A144-152 aa
PF06293Kdo195-243 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA08G095760PF02439Adeno_E3_CR28350.5110.9
TkA08G095760PF29279YLL006W-A9290.02815.2
TkA08G095760PF28423Epiregulin_C12390.1812.3
TkA08G095760PF00069Pkinase933683.4e-42145.4
TkA08G095760PF07714PK_Tyr_Ser-Thr943702.4e-44152.3
TkA08G095760PF03109ABC1941174.4e-0626.7
TkA08G095760PF29279YLL006W-A1441520.02815.2
TkA08G095760PF06293Kdo1952430.2511.5
TkA08G095760PF02439Adeno_E3_CR21962070.5110.9
TkA08G095760PF03109ABC12082494.4e-0626.7
TkA08G095760PF17667Pkinase_fungal2092710.0003620.1
TkA08G095760PF14531Kinase-like2103050.002717.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9LYN8Arabidopsis thalianasp|Q9LYN8|EMS1_ARATH Leucine-rich repeat receptor protein kinase EMS143.200%Swiss-ProtMedium
Q9FN37Arabidopsis thalianasp|Q9FN37|PSKR2_ARATH Phytosulfokine receptor 245.500%Swiss-ProtMedium
Q9ZVR7Arabidopsis thalianasp|Q9ZVR7|PSKR1_ARATH Phytosulfokine receptor 144.300%Swiss-ProtMedium
Q8RZV7Oryza sativa subsp. japonicasp|Q8RZV7|MSP1_ORYSJ Leucine-rich repeat receptor protein kinase MSP145.400%Swiss-ProtMedium

JBrowse

View in Genome Browser